Sequences from confirmation amplicon


Confirmation sequences for line 373G12 and hit At4g34610 are shown.
Line ID 373G12
Locus At4g34610 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr4:16531024
Primers used for PCR JU18 - 8474, show primer details
   
Sequence Name 03-K021056-022-373-G12C-8409
GenBank Accession LN487292 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>03-K021056-022-373-G12C-8409
GATCCATGTAGATTTCCCGGACATGAAGCCATTTACAATTGAATATATCCTGCATTCCAT
AAACGCACTCGTGCATTTATGAACCAGTTTGAAACCTTTTACAAACATAAAACACACAAC
AATCAATAAATAAACTATACTATGAAGAGAAAGAAACAATCTTCAAATAAAACATTCCTT
ACCTGACCGCGGCTCAAGCCCGTTTGTCTTGCTAGCATGATCTTATCAGAATCCTTTGGG
TAACTATTCATGTTTTCAAACAGTAATCATCACTATTTATGAAGAAAATGTGTGGAGATA
AGATTCAAGGGAGACTTACGGGTGAAGAAAATGCTCAAAGAGCCAAGCACGGAGAATCAA
AAC
   
Sequence Name 04-K021056-022-373-G12C-JU18
GenBank Accession LN487735 [GenBank]
Sequencing primer gene specific primer, JU18: 5'-GAAAACTCTGTTTTGATTCTCCGT-3'
Sequence (A. th genome BLAST matches underlined)
>04-K021056-022-373-G12C-JU18
CTTGGCTCTTTGAGCATTTTCTTCACCCGTAAGTCTCCCTTGAATCTTATCTCCACACAT
TTTCTTCATAAATAGTGATGATTACTGTTTGAAAACATGAATAGTTACCCAAAGGATTCT
GATAAGATCATGCTAGCAAGACAAACGGGCTTGAGCCGCGGTCAGGTAAGGAATGTTTTA
TTTGAAGATTGTTTCTTTCTCTTCATAGTATAGTTTATTTATTGATTGTTGTGTGTTTTA
TGTTTGTAAAAGGTTTCAAACTGGTTCATAAATGCACGAGTGCGTTTATGGAATGCAGGA
TATATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATG
ATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTA
GATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGACAAATTACGATC
CGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTATTTCG
ACGTGTCTACAT

Last Updated on 23.10.2014 13:25