SimpleSearch - Line and FST details


Line specific information

 
Line ID 373G12
Vector Used pAC161
Line Availability only available from NASC (N435796)
Segregation Analysis 100:100:78
Confirmed for Hit At4g34610
Parent of DUPLO pair none
Parent of pair(s) 7935

Gene hit At4g34610

 
Sequence (A. th genome BLAST matches underlined)
>95-K017159-022-373-G12-8409
TGATCTGTAGTTTCCCGGAATGAAGCCATTTACCTTGAATATATCCTGCATTCCATAAAC
GCACTCGTGCATTTATGAACCAGATTGAAACCTTTTACAAACCTAAAACTCTCAACACAT
CAATAAATAAACTATACTATGAAGAGAAAGANACTATCTTCAAGATAAAACATTCCTTAC
CTGACCGCGGCTCAAGCCCGTTTGTCTTGCTAGGGAATCTCTACCTACGCAACTGTGTCG
GATTCGGGTACACGTACCCTTTTGCTGAAGGTCTCTCGAGCTTTTCCTGGGAATATAGCA
TGGGTTACTTCATCGCCGGAGCGCCTGATACTCTAACATTGGCTCGAGGCATTTTCTCTA
CCCCTTCTTACCCTGAAAAAACTGGGACACCTTGCGACCTTGAACCGATAACCATCTTTC
GGCTAACCTATGGCATCTCCCCGATAGTGAGACCACTCNAAACCCTCGCGGTCAAGTATA
TAGCGATTTTGGGC
GenBank Accession BX003653 [GenBank]
Graphic View Graphic view of gene At4g34610
Predicted Position of Insertion Chr4:16531024 - go to primer design
BLAST e Value 8e-64
Hit Clone Code (BAC ID) T4L20
Hit Gene Code At4g34610 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation BEL1-like homeodomain 6
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03