Sequences from confirmation amplicon


Confirmation sequences for line 377E07 and hit At2g26380 are shown.
Line ID 377E07
Locus At2g26380 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr2:11228059
Primers used for PCR UF22 - 8474, show primer details
   
Sequence Name 02-K030138-022-377-E07C-8409
GenBank Accession LN486909 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>02-K030138-022-377-E07C-8409
GCCATTTACAATTGATTCAACTAAGCCATGAACTCTTGTTCTTTCCACAACTTCTTCATT
TTCACCGCCGTGATCTTTCTCCGGTGTTTAAACCCCACCGCAGCAGCCACGTGTCATCCT
GATGATGAGGCGGGTCTATTAGCTTTTAAATCGGGTATAACCAAAGATCCTTCAGGTATT
CTAAGCACTTGGAAAAAAGGTACTGATTGCTGCTCTTGGAACGGTGTCAGTTGCCCTAAC
GGCAACCGTGTCGTCGTACTCACTATCCGCATAGAGTCCGACGATGCCGGAATCTTTCTC
TCTGGCACAATCTCTCCGTCACTGGCCAAACTCCAGCATTTGGAAGGGGTCGTCTTTATC
AATCTCAAAAACATCACAGGACCATTTCCACCATTTTTATTCAGATTACCACATCTAAAG
TATGTTTACCTCGAGAATACACGTCTCTCTGGTCCTCTTCCAGCCAACATCGGCGCGCTT
AACCGCTTAGATACATTAACCGTTAAAGGAAACCGGTTCATCGGTTCAATCCCGAGTTCC
ATATCCAATTTAACTCGGTTAAACTACCTAAATCTTGGCGGTAATCTCTTAACCGGAACA
TTACCCGTTA
   
Sequence Name 02-K030138-022-377-E07C-UF22
GenBank Accession LN486910 [GenBank]
Sequencing primer gene specific primer, UF22: 5'-TAACGGTATTGTTCCGGTTAAGAG-3'
Sequence (A. th genome BLAST matches underlined)
>02-K030138-022-377-E07C-UF22
TTACCGAGTTAATTGGATATGGAACTCGGGATTGAACCGATGAACCGGTTTCCTTTAACG
GTTAATGTATCTAAGCGGTTAAGCGCGCCGATGTTGGCTGGAAGAGGACCAGAGAGACGT
GTATTCTCGAGGTAAACATACTTTAGATGTGGTAATCTGAATAAAAATGGTGGAAATGGT
CCTGTGATGTTTTTGAGATTGATAAAGACGACCCCTTCCAAATGCTGGAGTTTGGCCAGT
GACGGAGAGATTGTGCCAGAGAGAAAGATTCCGGCATCGTCGGACTCTATGCGGATAGTG
AGTACGACGACACGGTTGCCGTTAGGGCAACTGACACCGTTCCAAGAGCAGCAATCAGTA
CCTTTTTTCCAAGTGCTTAGAATACCTGAAGGATCTTTGGTTATACCCGATTTAAAAGCT
AATAGACCCGCCTCATCATCAGGATGACACGTGGCTGCTGCGGTGGGGTTTAAACACCGG
AGAAAGATCACGGCGGTGAAAATGAAGAAGTTGTGGAAAGAACAAGAGTTCATGGCTTAG
TTGAATCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATG
ATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCTTTTCAAAAATGTA
GATGTCCGCAGCGCTCTTATAAAATGAAAGTACATTTTGATAAAACGACAAATTACGATC
CGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTATTTCG
ACGTGTCT

Last Updated on 07.07.2016 14:16