SimpleSearch - Line and FST details


Line specific information

 
Line ID 377E07
Vector Used pAC161
Line Availability only available from NASC (N436151)
Segregation Analysis 50:50:50
Confirmed for Hit At2g26380
Parent of DUPLO pair none
Parent of pair(s) 7121, 7165, 9134, 97555, 97556
Note Although the line exists, the insertion in At4g03270 can not be ordered because the confirmation of this insertion failed.

Gene hit At4g03270

 
Sequence (A. th genome BLAST matches underlined)
>53-K017219-022-377-E07-8409
TCAGACTCTCTACCTCAGGATCACTCTGTAGCTATGAGACCTACGCACTATGGGATCCTC
CCTATATTGAGATCCCTTAACTTAAAACTCATGAATCTTTATAATGTGAATGTGTTTTAA
AGAGTAGATAAGTGTCTGAACATTGGATTTTTTTCAGGAGGAAGGTGATTTTTTTGATGC
TCACATGATAGACAGAATGGAGAATGTGATCCTATGGGATCCTCCCTATAGTGAGAGGAA
GenBank Accession BX004119 [GenBank]
Graphic View Graphic view of gene At4g03270
Predicted Position of Insertion Chr4:1433252 - go to primer design
BLAST e Value 3e-32
Hit Clone Code (BAC ID) F4C21
Hit Gene Code At4g03270 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Cyclin D6;1
Insertion Classification CDSi
Confirmation Status failed, line belongs to a contamination group, please check line 368E07

Gene hit T1G11

 
Sequence (A. th genome BLAST matches underlined)
>53-K017229-022-377-E07-8409
ATGTATTAATGCTATGGGATCATTCNTATAGTGAGATTCACTCTGTAGCTATGAGACCTA
CGCGCTATGGGATCCTCCCTATAGTGAGANNGNGNNNNTAAANNGTNGCGAAANAATTAA
TGNGAATGGGATATAAAAAATAGAAGAATGAAAGGATACAAGATTATGGACTAGAGAGAG
TGATACTTACCAAAAGA
GenBank Accession BX004120 [GenBank]
Graphic View Graphic view of sequence BX004120 of line 377E07
Predicted Position of Insertion Chr1:1325030 - go to primer design
BLAST e Value 1e-07
Hit Clone Code (BAC ID) T1G11
Insertion Classification Genome Hit
Confirmation Status unknown

Gene hit At4g38810

 
Sequence (A. th genome BLAST matches underlined)
>53-K026822-022-377-E07-8409
CATATTTTAATGCTAGTACTAGATGTTTTCGAATTGGCCGGCGTATGGGATCCTCCCTAT
AGTGAGGCGGATTACTCCCCCCTATGANCATTTGCCTCGGGGAAAACCATTGATCCTCCT
GGGATTCGTAACACTTGGAANACGGGGGGGGGGGGGGCGACAANNANGCCGAACCNTTCC
ACNATGCGATGAGTATGGNGGGTAATTACTCCCCTGNAAAGAAGGAAGACGCAGGAAGAG
GAAGAGNAAATAGAGAGAAGCGATCAAAGTAAACAGGATTATTGATAGGGGGCGCAGGTA
AGAAAAGAAAGAAATA
GenBank Accession FR809113 [GenBank]
Graphic View Graphic view of gene At4g38810
Predicted Position of Insertion Chr4:18118467 - go to primer design
BLAST e Value 9e-07
Hit Clone Code (BAC ID) T9A14
Hit Gene Code At4g38810 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Calcium-binding EF-hand family protein
Insertion Classification TS2TE (5')
Confirmation Status unknown

Gene hit At2g26380

 
Sequence (A. th genome BLAST matches underlined)
>53-K026788-022-377-E07-8409
TGAAGCCATTACAATTGAATATATCCTGCCAGAACGGGAGGAGTTATTCCTGCAGGTCGT
CGGTTTCACCGCCTTGATCGGGCTCGGGAGCTTACCCACCGCTGAGATTCAACCACGTGT
CATCCTGATGATGAGGCGGCTCTATTACCTTTTACATCGGGTATAACCAAAGATCCTTCT
GGTATTCTAAGCACTTGGAAAAAAGGTATGGGATCCTCCCTATAGTGAGATCCATGANAC
CANCCGACGCACCGGGCAGGCGCGCAACACGATCGCAAATTATTTGAACGCGGGTATGAA
ATCCTCCCTATAGTAAGTAGGGACGACTCTCGGACTTTAGAGGATTGAAATGAGAGGACA
TAGAGACATCTATAATTATGATAGAAAAAGGAGTTATGA
GenBank Accession CR396617 [GenBank]
Graphic View Graphic view of gene At2g26380
Predicted Position of Insertion Chr2:11228056 - go to primer design
BLAST e Value 9e-38
Hit Clone Code (BAC ID) T9J22
Hit Gene Code At2g26380 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Leucine-rich repeat (LRR) family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23