Sequences from confirmation amplicon


Confirmation sequences for line 379A05 and hit At1g32080 are shown.
Line ID 379A05
Locus At1g32080 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:11539827
Primers used for PCR RU23 - 8474, show primer details
   
Sequence Name 49-K023021-022-379-A05C-8409
GenBank Accession LN506699 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>49-K023021-022-379-A05C-8409
AAATTTCCCGGACATGAAGCCATTTACCATTGAATATATCCATGTAGATTTCCCGGACAT
GTAGATTTCTGATGTTTGTGATTGAAATTGGATTACGATATTTGTATGGACAAGAGAGAA
AGTTCTATCGACAAGAGGATCCAGTTTTGTCTTTTTCCGGGTTAGGTTTTTCCGTTAAGA
AAGGTCTTTTGTCTACTTTAATTTAATATTAATATAGTTTTTGATACATCTTTTTTATTA
GAGTATTTTCTAACGTAACTTTTATCATATCCAATAAACCAAATTTTACAATTACAATAG
GCTTGAAAGATGACAATAAATTAAATCTTCGAATATATTTTCATACAAGTGAATGACACT
AACACCAATTTCCTAACCTTTAAAACCGAAACCAAAGTCAGCTAACAAATAACCTAAACC
TAGACCAAAAGAAACCTTTAGTTATGACACTCATAAGAGATTACATATTTTTCTTCTGTC
TAGAGATCAATTGTAACGGTACTCATGCTCCTCGTACTGATGAGTATTGTAGTGATATTC
ATACTGAG
   
Sequence Name 50-K023021-022-379-A05C-RU23
GenBank Accession LN507042 [GenBank]
Sequencing primer gene specific primer, RU23: 5'-CTTATGAGCAGTCATCGTCTCAGT-3'
Sequence (A. th genome BLAST matches underlined)
>50-K023021-022-379-A05C-RU23
AATATCACTACAATACTCATCAGTACGAGGAGCATGAGTACCGTTACAATTGATCTCTAG
ACAGAAGAAAAATATGTAATCTCTTATGAGTGTCATAACTAAAGGTTTCTTTTGGTCTAG
GTTTAGGTTATTTGTTAGCTGACTTTGGTTTCGGTTTTAAAGGTTAGGAAATTGGTGTTA
GTGTCATTCACTTGTATGAAAATATATTCGAAGATTTAATTTATTGTCATCTTTCAAGCC
TATTGTAATTGTAAAATTTGGTTTATTGGATATGATAAAAGTTACGTTAGAAAATACTCT
AATAAAAAAGATGTATCAAAAACTATATTAATATTAAATTAAAGTAGACAAAAGACCTTT
CTTAACGGAAAAACCTAACCCGGAAAAAGACAAAACTGGATCCTCTTGTCGATAGAACTT
TCTCTCTTGTCCATACAAATATCGTAATCCAATTTCAATCACAAACATCAGAAATCTACA
TGTCCGGGAAATCTACATGGATATATTCAATGGTAAATGGCTTCATGTCCGGGAAATCTA
CATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATT
TTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTG
ATAAAACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCT

Last Updated on 07.07.2016 14:16