SimpleSearch - Line and FST details


Line specific information

 
Line ID 379A05
Vector Used pAC161
Line Availability only available from NASC (N436293)
Segregation Analysis 100:95:76
Confirmed for Hit At1g32080
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit T10O24

 
Sequence (A. th genome BLAST matches underlined)
>33-K017231-022-379-A05-8409
TGTCCTACCTATAGAATTATCAAAGTCATAGATATTTTGGCTGACTTTGGAGATCTGCAT
CGTTCAAGAACATATAGTTTACGTACATAAGCTATGGGATCCTCCCTATAGTGAGANGNN
NTNNANACNTGNNTNNNANGNNAGTTTTTTCTACNATACTCTTTGTGGGAGGGGGTACAC
TCTATGGGACCACTACCGGAGGAGTGCGATCTTTGACGATGGGATGTCTTTTATAACAAT
GTTGTCATACTGAGGGAGTGCCCTACCTCTACTTCTCATATCGCTGAAAAGTGACACATA
AGTCTGCTATCGGATCACCCGTGCCTTGAACAAGATACACCTTTATTTATGACCTTCCTA
AGAGATTGCGTATTTTTCATCTGGCTATGGGAACCTCCGTGTAGTAAGATAGTGAGCGGC
TCTCTCTTGTTGACAAAAAGTCCCTCCATATAGCGAGGGAGCGGATCCCCCTGTGTAACC
AGTTAACCCGCGGTTGAACCCGACATGTGTTTTGGGCCCCCAGGGAACATGTGGCCCCCC
AGGGGATACCGGCCCTTTCTCTGGGGAGACCCCGCATCATGGGGAGGACAGCAAAAGGGA
AAAGCCAAAAACTGGACCAACAAAGGAAAGGAGAAGAAAA
GenBank Accession BX004298 [GenBank]
Graphic View Graphic view of sequence BX004298 of line 379A05
Predicted Position of Insertion Chr1:3446730 - go to primer design
BLAST e Value 2e-33
Hit Clone Code (BAC ID) T10O24
Insertion Classification Genome Hit
Confirmation Status unknown

Gene hit At1g32080

 
Sequence (A. th genome BLAST matches underlined)
>33-K017221-022-379-A05-8409
TATACTATGATTTCCTCGACATGAAGCATTTACTCTTGAATATATCCTGGCCATATGAAA
TTACATTTCGTTTGGTTAATTATATTCATTTTTGTTTAGTCTATATTTTCAAAAGTGACA
ATTACGATATCCATTTTGATTGAAAAGTGTTCAGGGCTTTGGTTGGGTTTAACTGTCCGA
CCCTATGGGATCCTCCNCTATAGTGAGATAATATTAATATAGTTTTTGATACATCTTTTT
TATTANAGTATTTTCTAACGTAACTTTTATCATATCCAATAAACCAAATTTTACAATTAC
AATAGGCTTGAAAGATGACAATAAATTAAATCTTCGAATATATTTTCATACAAGTGAATG
ACACTAACACCAATTTCCTAACCTTTAAAACCGAAACCAAAGTCAGCTAACAAATAACCT
AAACCTATGGGATCCTCCCTATAGTGAG
GenBank Accession BX004297 [GenBank]
Graphic View Graphic view of gene At1g32080
Predicted Position of Insertion Chr1:11539811 - go to primer design
BLAST e Value 1e-118
Hit Clone Code (BAC ID) T12O21
Hit Gene Code At1g32080 [TAIR] [MIPS] [SIGnAL]
Gene Annotation membrane protein, putative
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23