Sequences from confirmation amplicon


Confirmation sequences for line 380D03 and hit At5g05820 are shown.
Line ID 380D03
Locus At5g05820 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr5:1752399
Primers used for PCR RU40 - 8474, show primer details
   
Sequence Name 09-K023835-022-380-D03C-8409
GenBank Accession LN490002 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>09-K023835-022-380-D03C-8409
TAGATTTCCCGGACATGAAGCCATTTACAATTGAATATATCCTGAAAACCAACCCAAATC
AATCACTAACAGCCATGATAATGCACAAAGAAAAAGTCAACATGGCATAAAGAAAAAGTC
AACCCGGTGGAGCTTGCATATTGTTTATTCTCATAGCATAATTGGTTTGCCCTTTTGTGC
ATTATTGGTTTATCCTTTATGATTGATCTCACTAACAGGAGGACCAAGCAGATAATCGTT
TCTCACTAGTTCTACACTTCCTTGGACTAACTTTCTTTCAACTCCAACCAAAACCCGTAT
CATTTTTTCTACCATAAACAATGATGCCACTAAGAATGTAAAAGGAATGTGAACTGTAAT
CACCTGTAAAGTCAGGGCGCTAGTGTGGTTTGTGACTAAGAAATTTGTCAAGTTGACTAA
ATAGGCGAGCGCTGAATTGAATAGAAGATACCAAACGATTCTGAAATCATCTCTTGCAAG
TGCAATTGTAATGCCGACAACATTTTTCTCCATGATAAGAGTAGCAGGCAGAAGGAGCAC
GACAGCTATTGGAGCCATGTAA
   
Sequence Name 13-K023835-022-380-D03C-RU40
GenBank Accession LN491859 [GenBank]
Sequencing primer gene specific primer, RU40: 5'-GAACTCCATGAATCTCCTCCTTTA-3'
Sequence (A. th genome BLAST matches underlined)
>13-K023835-022-380-D03C-RU40
AATAGCTGTCGTGCTCCTTCTGCCTGCTACTCTTATCATGGAGAAAAATGTTGTCGGCAT
TACAATTGCACTTGCAAGAGATGATTTCAGAATCGTTTGGTATCTTCTATTCAATTCAGC
GCTCGCCTATTTAGTCAACTTGACAAATTTCTTAGTCACAAACCACACTAGCGCCCTGAC
TTTACAGGTGATTACAGTTCACATTCCTTTTACATTCTTAGTGGCATCATTGTTTATGGT
AGAAAAAATGATACGGGTTTTGGTTGGAGTTGAAAGAAAGTTAGTCCAAGGAAGTGTAGA
ACTAGTGAGAAACGATTATCTGCTTGGTCCTCCTGTTAGTGAGATCAATCATAAAGGATA
AACCAATAATGCACAAAAGGGCAAACCAATTATGCTATGAGAATAAACAATATGCAAGCT
CCACCGGGTTGACTTTTTCTTTATGCCATGTTGACTTTTTCTTTGTGCATTATCATGGCT
GTTAGTGATTGATTTGGGTTGGTTTTCAGGATATATTCAATTGTAAATGGCTTCATGTCC
GGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGA

Last Updated on 23.10.2014 13:25