SimpleSearch - Line and FST details


Line specific information

 
Line ID 380D03
Vector Used pAC161
Line Availability only available from NASC (N436423)
Segregation Analysis 50:50:34
Confirmed for Hit At5g05820
Parent of DUPLO pair none
Parent of pair(s) 97131, 97134, 97136, 97137

Gene hit At5g05820

 
Sequence (A. th genome BLAST matches underlined)
>20-K017232-022-380-D03-8409
TGATCTGTAATTTCCCGGACTGAAGCCATTTACACTGAATATATCCTGCCGCCGCTGCCG
CTTTGCACCCAGAGGAGCTTAGCATGGCGCGTTCACAAATGGCTTCGTGTACAATTGAAG
GCATACACACAATGGCTATCGCCCATGATAATAGAACCATACAATCATGGCTTCGTCGAT
AAACAAGCGCATTTGTGGGTCCGCTATGATTAAGCGCACGATAATGCTGGATGTTCCCAG
CGTCTCATCACGATCTTTCGACACATGATTCGCATAAACTCATAAACACCTCCTCCGGAT
CCCTCAGCGATATGTGCTATGGGACTGCCTGAACACTGAGAATGTAAAAGGAATGTGAAC
TGTAATCACCTGTAAAGTCAGGGCGCTATGG
GenBank Accession BX004460 [GenBank]
Graphic View Graphic view of gene At5g05820
Predicted Position of Insertion Chr5:1752522 - go to primer design
BLAST e Value 3e-20
Hit Clone Code (BAC ID) MJJ3
Hit Gene Code At5g05820 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Nucleotide-sugar transporter family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX004460 [GenBank]


Last Updated on 31.08.2016 09:40