Sequences from confirmation amplicon


Confirmation sequences for line 381A04 and hit At5g42190 are shown.
Line ID 381A04
Locus At5g42190 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr5:16855621
Primers used for PCR JP02 - 8474, show primer details
   
Sequence Name 21-K021337-022-381-A04C-8409
GenBank Accession LN495480 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>21-K021337-022-381-A04C-8409
GTAGATTTCCCGGACATGAAGCCATTTACAATTGAATATATCCTCATGTAGAAAAACATT
GCTGACCATCATAATATGTCAACAACATTTTTCAGCCAGTCAGGTGTTTGAGCCGGGCTT
TAAAAACATTTTGATTTAACCCATACACACATCTCTCTGTTCCACGATTCTCTTCCTCAG
CCTCCACGTCGTCTCTAAACTCAGCAAAAACCAATGTCGACGGTGAGAAAAATCACTCTT
AAGAGTTCGGATGGCGAAAACTTCGAAATTGACGAAGCGGTGGCGCTAGAGTCACAAACC
ATCAAACATATGATTGAAGATGACTGTACCGATAATGGTATCCCTCTCCCTAATGTCACA
AGCAAGATCCTTTCGAAGGTGATTGAGTACTGTAAGAGACATGTCGAAGCTGCTGAGAAA
TCCGAAACCACGGCCGATGCTGCTGCTGCTACTACTACCACCACCGTCGCGTCGGGTTCT
AGTGATGAAGATCTCAAGACTTGGGATTCTGAGTTTATCAAAGTTGATCAGGGCACTCTC
TTCGATCTTA
   
Sequence Name 22-K021337-022-381-A04C-JP02
GenBank Accession LN495928 [GenBank]
Sequencing primer gene specific primer, JP02: 5'-ACAAACCAGGATAAGATCGAAGAG-3'
Sequence (A. th genome BLAST matches underlined)
>22-K021337-022-381-A04C-JP02
CTGATCAACTTTGATAAACTCAGAATCCCAAGTCTTGAGATCTTCATCACTAGAACCCGA
CGCGACGGTGGTGGTAGTAGTAGCAGCAGCAGCATCGGCCGTGGTTTCGGATTTCTCAGC
AGCTTCGACATGTCTCTTACAGTACTCAATCACCTTCGAAAGGATCTTGCTTGTGACATT
AGGGAGAGGGATACCATTATCGGTACAGTCATCTTCAATCATATGTTTGATGGTTTGTGA
CTCTAGCGCCACCGCTTCGTCAATTTCGAAGTTTTCGCCATCCGAACTCTTAAGAGTGAT
TTTTCTCACCGTCGACATTGGTTTTTGCTGAGTTTAGAGACGACGTGGAGGCTGAGGAAG
AGAATCGTGGAACAGAGAGATGTGTGTATGGGTTAAATCAAAATGTTTTTAAAGCCCGGC
TCAAACACCTGACTGGCTGAAAAATGTTGTTGACATATTATGATGGTCAGCAATGTTTTT
CTACATGAGGATATATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAG
CAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAAT
TCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGAC
AAATTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAA
TCTTTATNTCGACGTGTCTA

Last Updated on 07.07.2016 14:16