SimpleSearch - Line and FST details


Line specific information

 
Line ID 381A04
Vector Used pAC161
Line Availability only available from NASC (N436484)
Segregation Analysis 100:96:70
Confirmed for Hit At5g42190
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g42190

 
Sequence (A. th genome BLAST matches underlined)
>25-K017264-022-381-A04-8409
ATGATTTGCACGCTAGAAGTCCCACATCTCTTGCCTATGGGATCCTCCCTATAGTGAGGT
TCCACGATTCTCTTCCTCAGCCTCCACGTCGTCTCTAAACTCAGCAAAAACCAATGTCGA
CGGTGAGAAAAATCACTCTTAAGAGTTCGGATGGCGAAAACTTCGAAATTGACGAAGCGG
TGGCACTATGGGATCCTCCCTATAGTGAGAANACCCNCAATCACTTGCGGCGTATGGGAT
CGCTCACAGACGTGAGATCACTCACCGTCTTAAAAGACAGAACACTATGGGATCCTCCCT
ATAGTGAGACCCGCCAACTACCCGGCGGCTTCCGGGCAGGGGAGAGGGCGCGCCCAGCGG
GTGGCGGTAGGGGGGAGGGATATAACGCGGGGACGGCGAAGGCGCGGGAGGGGAGGGAGC
CGAACGGGCGGCGGCGGAGGAGGGCGGATAATGGGGGGCGCACCGAGATGATAAAAGTGG
GGAAGGGAAGGGGAGCGAGCAGACGGCACCGCACTGCGCCCCCCCCCGGGAGGATTTGAG
AGAGAGAGGGGG
GenBank Accession BX004541 [GenBank]
Graphic View Graphic view of gene At5g42190
Predicted Position of Insertion Chr5:16855689 - go to primer design
BLAST e Value 5e-65
Hit Clone Code (BAC ID) MJC20
Hit Gene Code At5g42190 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation E3 ubiquitin ligase SCF complex subunit SKP1/ASK1 family protein
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX004542 [GenBank] BX004541 [GenBank]


Last Updated on 31.08.2016 09:40