Sequences from confirmation amplicon


Confirmation sequences for line 381A12 and hit At5g60190 are shown.
Line ID 381A12
Locus At5g60190 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr5:24235744
Primers used for PCR ME04 - 8474, show primer details
   
Sequence Name 19-K023369-022-381-A12C-8409
GenBank Accession LN494586 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>19-K023369-022-381-A12C-8409
TAGATTTCCCGGACATGAAGCCATTTACAATTGAATATATCCGGAGAAACCGCCTTGAAG
AGCTGTTTCGCGCTCCATCTATTCACTCCCATGTAGCTATCGTGATGGACAAACGTGTTG
GCCTCTTTGTAGTACACGAGTAAGCTCCAATGTAATCCGCCTTCTGCTACCTCGACATTT
GAATTGTCGTTTACAGGGAGTATCAGGAGGTCTTTGTCGCGCAAATTAAGTGGTTTCATG
AAATCTTTGAGGTATTCGGTGTCCGGGCAGTTTGAGATCCAGAAAGCAATGGAGGGAGGG
ATTAGCGAGATGGTAGTGGAACTGTGAACCGTGGATAAGAAGCTAAGGTAGAACTCGATA
ACACGATCGTTTAGAAAAATGGGTCCGTTTAGGATGTCCAAATCTGATCTCCTGAGGACA
ACATCTTCATAGCTGAGGATCTTGTCGTCATCAGAAGTATTTCCCATAGCGTATACTGAT
AAGCTTCAACTGGCTACACCGGAGAATCCAGAAACTCTGCAATTTACAAAAATGAAATCT
GTTAAGCCAAAATACAAATTGTGAAAAGATGAATTCTCAGAAAGTAGTAAACGCACACAA
AAGTGAGTAAGGGATCGAAAGATTCAAAAAGATGAATTGCTTTGTCAATAAGCAACCTTG
TCTTTAGCTTAAGCTAGAACTG
   
Sequence Name 20-K023369-022-381-A12C-ME04
GenBank Accession LN495042 [GenBank]
Sequencing primer gene specific primer, ME04: 5'-CTTTAGGCAGTTTCTTTCCTCTGA-3'
Sequence (A. th genome BLAST matches underlined)
>20-K023369-022-381-A12C-ME04
TCCAGTCTTTGTTTTCTGTCAATAATCGAATTCGAGAATCGCTGCTTTTATCTGGTTGTA
TTTGTTCGGAGAAATTTGATCCTTGCTTGTAGATATTGTAAGAACAATTTGTGATACACT
CAAACTGTTCGATAAAATGCCTGAACGAAACTTTGCTTCTTTTGCAATCTTTGATGCGAA
GTATGAAATAATATTTTCTTGAGCATATAGGTTGATGCAATTAGGTGATCTAAATTTCCA
ATATCAAACTGATGACGTTTACATATTCCCTGGGAATTGTCAGCTGTTCATCAATAGCAT
TTTCTAGTTAGCCTTTATGCTTGACATTAAGATCTCATGTTACTGATAACGTTCTAGCTC
GTGGTTAGAATGAACAAGAAGCAGTTCTAGCTTAAGCTAAAGACAAGGTTGCTTATTGAC
AAAGCAATTCATCTTTTTGAATCTTTCGATCCCTTACTCACTTTTGTGTGCGTTTACTAC
TTTCTGAGAATTCATCTTTTCACAATTTGTATTTTGGCTTAACAGATTTCATTTTTGTAA
ATTGCAGAGTTTCTGGATTCTCCGGTGTAGCCAGTTGAAGCTTATCAGTATACGCTATGG
GAAATACTTCTGATGACGACAAGATCCTCAGCTATGAAGATGTTGTCCTCAGGAGATCAG
ATTTGGACATCCTAAACGGACCCATTTTTCTAAACGATCGTGTTATCGAGTTCTACCTTA
GCTTCTTATCCACGGTTCACAGTTCCACTACCATCTCGCTAATCCCTCCCTCCATTGCTT
TCTGGATCTCAAACT
Primers used for PCR ME05 - 8474, show primer details
   
Sequence Name 22-K023369-022-381-A12C-ME05
GenBank Accession LN495941 [GenBank]
Sequencing primer gene specific primer, ME05: 5'-AAAACAGTTAAAATCATCCAACCG-3'
Sequence (A. th genome BLAST matches underlined)
>22-K023369-022-381-A12C-ME05
AATATCTAACCACGTTCAATAACCATCTCTCACTTACTCACACTCTCAGACATCAACTTC
TTGATCAGCGCCAAAATCTCTTCTCTCAGATGGTTAACCAGATCTGGTACAGTCTCCTTC
ACATTAGCAAACCACAGCTCATCCCGGTTCTTCATTCCTCCAGAGCTGAACCATTCACAT
ATTACCCGAGCGGTAGCAAGAAGGAAAACACCGCAGTCGTACCCATTCTTTTGCTGTGGT
GTATCAGTGCATTCCTTGTATGATGCATCTCCATTAGACAAATTGTAAATGGCTTCATGT
CCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAG
TAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGA
AAGTACATTTTGATAAAACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAATAA
ACAAATTATTCTAATTCGGAAATCTTTATTTCGACGTGTCTACATTC

Last Updated on 23.10.2014 13:25