SimpleSearch - Line and FST details


Line specific information

 
Line ID 381A12
Vector Used pAC161
Line Availability only available from NASC (N436492)
Segregation Analysis 100:96:77
Confirmed for Hit At5g60190
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g60190

 
Sequence (A. th genome BLAST matches underlined)
>89-K017264-022-381-A12-8409
TGTCATGAGATTTCCCGGACATGAAGCCATTTACTTCTGGTCTAATCGGAGATGCATCAT
ACAAGGAATCGCACTGATACACCACAGCAAAAGAATGGGTACGACTGCGGTGTTTTCCTT
CTTGCTACCGCTCGGGTAATATGTGAATGGTTCAGCTCTGGAGGAATGAAGAACCGGGAT
GAGCTGTGGTTTGCTAATGTGAAGGAGACTGTACCAGATCTGGTTAACCATCTGAGAGAA
GAGATTTTGGCGCTGATCAAGAAGTTGATGTCTGAGAGTGTGAGTAAGTGAGAGATGGTT
ATTGAACGTGGTTAGATATTCCGGTTGGATGATTTTAACTGTTTTCCGGAACTTCAAACA
GTTGATATTTTAACCGGTTGTTGAAATCAACTGTTTTACTCTATTTTAACTGGTAAAGTC
AGAACAAGACTACTATTTGAGCCCATTGTTTTGGTGAGCCTATGGGATCCTCCCTTATAG
TGAG
GenBank Accession BX004552 [GenBank]
Graphic View Graphic view of gene At5g60190
Predicted Position of Insertion Chr5:24235757 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F15L12
Hit Gene Code At5g60190 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Cysteine proteinases superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX004553 [GenBank]


Last Updated on 14.10.2014 10:23