Sequences from confirmation amplicon


Confirmation sequences for line 381B06 and hit At2g18420 are shown.
Line ID 381B06
Locus At2g18420 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr2:7993799
Primers used for PCR MR92 - 8474, show primer details
   
Sequence Name 13-K021340-022-381-B06C-8409
GenBank Accession LN491843 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>13-K021340-022-381-B06C-8409
TAGATTTCCCGGACATGAAGCCATTTACAATTGTCATTGCAACAACCAAAAACATTCATT
TGTCATTTTGTCTCCTCTTTTGTTTTCTCTGATCACTAGTATGGCTGTATTCAGAGTCTT
GCTTGCTTCTCTTCTCATATCTCTTCTTGTCCTCGACTTCGTCCATGCCGATATGGTGGT
ACAATTTTAACAACCAAATATATTTTCTTATTTGATTTTATTTTTTCACAACTTTTGTCT
ACGTTCTAATGGAATTTTTTTCAAAATATTCATGCAGACGTCGAATGACGCCCCTAAAAT
CGGTAATATCTCTATCATATAAACACGTACGTTGAATTTCTATATACGTGTGTTTAATTG
AAGTTTTGGTTGGAAATTGTATGTATTTGTAGATTGCAACAGCAGGTGCCAAGAGCGGTG
CAGTCTTTCGAGTAGGCCAAATCTTTGTCACAGAGCGTGCGGGACTTGCTGCGCTAGGTG
CAACTGCGTGGCACCGGGCACATCCGGAAACTACAACAAATGTCCGTGCTATGGTA
   
Sequence Name 14-K021340-022-381-B06C-MR92
GenBank Accession LN492312 [GenBank]
Sequencing primer gene specific primer, MR92: 5'-ATGATACATGGGGTTTGATTGTTT-3'
Sequence (A. th genome BLAST matches underlined)
>14-K021340-022-381-B06C-mr92
GGTATCTTGCTTTTTTGTCCGGTTTGATCTTGAATATGTTACATTACACTGCAGTATACT
GTTGAAGATATGATTGATGCTTCTTTTGTTGAAGCTCATGTTATATAGAATATAGAATAA
TAGTTGAACGATTAATTATGCGGTGAATTTATTTGCCTCGAAGAGTCAAGACTCAAGACT
ATTATTAACTTTATAGAGGTTATACCTTTCTAGGAATCTTGTACAAAAATGTAATAAAAA
TCGTACTGTTACTTCTATATATAATACATTCAACCCGGAAACATTAATTAAACGTAATTT
CATATACTATCTTTCATAATTTTATTGGTATTGTTGGTAACGTTACATATTCAATCGCTC
TCAGTTTTACGTCATAGTTCATTAAGTCCCCTCCAATTCTGTTGTTACCATATTTAAACC
CATTGCCTAACTTCCATGAGTAAAAAAAGAAAACTCTTTTACTTCTCTCTTCATTCTTTA
TTTTATATGCAAGTACGATGCCTATTTAGTGAATTGTATAATGAAAAACAATACCTTTTC
AGACCTAATGTTAACCAGGAACCAAACCAACAAGTACAAATTGGATAAACACTAAAACAA
AGATCGAAGAGTTGCACATGACGTATAACATTCTCTTTCTTTTGCTTTTTAATAATTCCC
AAGAAAATAACCACAATTACTCTCATAAAAGTAAAGTATTATAAACGAAATCAAATCAAA
CAGCGACAGAGTTTTTAAGGACACTTTCTGC

Last Updated on 23.10.2014 13:25