SimpleSearch - Line and FST details


Line specific information

 
Line ID 381B06
Vector Used pAC161
Line Availability only available from NASC (N436498)
Segregation Analysis 100:98:77
Confirmed for Hit At2g18420
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g18420

 
Sequence (A. th genome BLAST matches underlined)
>42-K017268-022-381-B06-8409
TGATCTGAGATTTCCCGGACTGAAGCCATTTACATTGAATTTTCATGCACATAACTCTCC
TATCAATCAGTATGTCTCGCCTAGCTGTACAAAACCATTTTTAACTTCTATAACATCAAA
ACAATCGCTCTCTCTACATTGCTCTATGGGATCCTCCCCTATACTTGAGACATGCCGATA
TGGTGGTACAATTTTAACAACCAAATATATTTTCTTATTTGATTTTATTTTTTCACAACT
TTTGTCTACGTTCTAATGGAATTTTTTTCAAAATATTCATGCAGACGTCGAATGACGCCC
CTAAAATCGGTAATATCTCTATCATATAAACACGTACGTTGAATTTCTATATACGTGTGT
TTAATTGAAGTTTTGGTTGGAAATTGTATGTATTTGTAGATTGCAACAGCAGGTGCCAAG
AGCGGTGCAGTCTTTCGAGTAGGCCAAATCTTTGTCACAGAGCGTGCGGGACTTGCTGCG
CTATGGG
GenBank Accession BX004564 [GenBank]
Graphic View Graphic view of gene At2g18420
Predicted Position of Insertion Chr2:7993812 - go to primer design
BLAST e Value 1e-117
Hit Clone Code (BAC ID) T30D6
Hit Gene Code At2g18420 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Gibberellin-regulated family protein
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR396868 [GenBank] BX004563 [GenBank]


Last Updated on 07.07.2016 14:03