Sequences from confirmation amplicon


Confirmation sequences for line 387E02 and hit At5g48710 are shown.
Line ID 387E02
Locus At5g48710 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr5:19755503
Primers used for PCR PG29 - 8474, show primer details
   
Sequence Name 41-K101745-0022-387-E02C-8409
GenBank Accession LN504023 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>41-K101745-0022-387-E02C-8409
CGGAATGAGCCTTTACAATTGAATATTTCCATGTAGATTTCCCGACACAACTTTACGCTT
TTGCCCTTCCATCTTCACTTCATTGCTTCCAACTCTGCTCGTTGTTGACATTATCTCAAC
CGGTCTGAACAGATATTTCAGTTCTCAATAAATGAATACACAGAAATAAACAAGAACAGT
ACAGTACAGATCATGACCGATCACTCGGCTTGGCGGCTCAAACGGCGAAGTGGACGGCTC
TACAGTAAAGATCTGCGGTGGTTCAAGCCCATGGTTGTTAGGTATAATGGTTCAACAATC
AAAGGCAAAACAGAGATTAGATCTAGGATTTGGATGACTTGCAGCACAAGCAACATATCC
TATAACCAAAACAGAAAATTCCTGCGCAAGTTACAGAATAAGTCTAGGGTTTTCTTACCC
TTAACCGCCTCGAAGATTGGCTACGACTGCTCCGGTGACAGTACGAAGGGGACAACAATA
AACAATGGTGGCTCAACTGTCTCTCTCCCACTCACGTGGTGGCTGCTTTTGGGTTTTGAT
ATGCTCAGTGTTTCTTTTGCAAACCCCTCGTCGTTTTTAACCCAAGGATGAAGTTGGGCC
TTAATGGGCTGAAATTTATG
   
Sequence Name 41-K101751-0022-387-E02C-PG29
GenBank Accession LN504024 [GenBank]
Sequencing primer gene specific primer, PG29: 5'-TCATAAATATCAGCCCATTAAGGC-3'
Sequence (A. th genome BLAST matches underlined)
>41-K101751-0022-387-E02C-PG29
GGGGTTTGCAAAGAACACTGAGCATATCAAAACCCAAAAGCAGCCACCACGTGAGTGGGA
GAGAGACAGTTGAGCCACCATTGTTTATTGTTGTCCCCTTCGTACTGTCACCGGAGCAGT
CGTAGCCAATCTTCGAGGCGGTTAAGGGTAAGAAAACCCTAGACTTATTCTGTAACTTGC
GCAGGAATTTTCTGTTTTGGTTATAGGATATGTTGCTTGTGCTGCAAGTCATCCAAATCC
TAGATCTAATCTCTGTTTTGCCTTTGATTGTTGAACCATTATACCTAACAACCATGGGCT
TGAACCACCGCAGATCTTTACTGTAGAGCCGTCCACTTCGCCGTTTGAGCCGCCNAGCCG
AGTGATCGGTCATGATCTGTACTGTACTGTTCTTGTTTATTTCTGTGTATTCATTTATTG
AGAACTGAAATATCTGTTCAGACCGGTTGAGATAATGTCAACAACGAGCAGAGTTGGAAG
CAATGAAGTGAAGATGGAAGGGCAAAAGCGTAAAGTTGTGTCGGGAAATCTACATGGAAA
TATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGAT
GGTCAATATGGAGAANAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAG

Last Updated on 07.07.2016 14:16