SimpleSearch - Line and FST details


Line specific information

 
Line ID 387E02
Vector Used pAC161
Line Availability only available from NASC (N437106)
Segregation Analysis 50:49:45
Confirmed for Hit At5g48710
Parent of DUPLO pair none
Parent of pair(s) 11738

Gene hit At5g48710

 
Sequence (A. th genome BLAST matches underlined)
>13-K018250-022-387-E02-8409
TTTCCCGGACTGAAGCCTTTACATTGAATATTTCCATGTAGATTTCCCGACACAACTTTA
CGCTTTTGCCCTTCCATCTTCACTTCATTGCTTCCAACTCTGCTCGTTGTTGACATTATC
TCAACCGGTCTGAACAGATATTTCAGTTCTCAATAAATGAATACACAGAAATAAACAAGA
ACAGTACAGTACAGATCATGACCGATCACTCGGCTTGGCGGCTCAAACGGCGAAGTGGAC
GGCTCTACAGTAAAGATCTGCGGTGGTTCAAGCCCATGGTTGTTAGGTATAATGGTTCAA
CAATCAAAGGCAAAACAGAGATTAGATCTAGGATTTGGATGACTTGCAGCACAAGCAACA
TATCCTATAACCAAAACAGAAAATTCCTGCGCAAGTTACAGAATAAGCCTATGGG
GenBank Accession BX286000 [GenBank]
Graphic View Graphic view of gene At5g48710
Predicted Position of Insertion Chr5:19755503 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) K24G6
Hit Gene Code At5g48710 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Ubiquitin-like superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23