Sequences from confirmation amplicon


Confirmation sequences for line 393H03 and hit At4g12330 are shown.
Line ID 393H03
Locus At4g12330 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr4:7319033
Primers used for PCR ZZ82 - 8474, show primer details
   
Sequence Name 25-K023835-022-393-H03C-8409
GenBank Accession LN497270 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>25-K023835-022-393-H03C-8409
TAGATTTCCCGGACATGAAGCCATTTACAATTGAATATATCCTGAACAGGGCGGCAACAG
TTTCTCCCCACAACATCTGAGTCACCACATTTAATATCGTGACAAATATTTGTTCTCCAA
CGTTAACCGCCAACCCGGCCCGAGCCCGGTCTGCCAAATACCGGACTGTTCGCCTGGTCT
CCTGGCGGCGAAGTGCACTAAAAGAATTTGAATCCAACGTGGCGTTGCTTAACATTTTGT
TAATGCAGATTTTTCTTAGCATTGGCCATTCTGGTCCGTACGGTGACCAGACAATGTCTA
CGCCACCATACGTGCTGAGTGAGCCTGCGACGGGAACGTCGTCGTTCGCAAAGATGACGT
CATTAGTTCTTAGAATATCCCGCGTTGCTTCGGAAGAGGTTATCAC
   
Sequence Name 29-K023835-022-393-H03C-ZZ82
GenBank Accession LN499122 [GenBank]
Sequencing primer gene specific primer, ZZ82: 5'-CTAACCATCGTGATAACCTCTTCC-3'
Sequence (A. th genome BLAST matches underlined)
>29-K023835-022-393-H03C-zz82
GCGGGATATTCTAAGAACTAATGACGTCATCTTTGCGAACGACGACGTTCCCGTCGCAGG
CTCACTCAGCACGTATGGTGGCGTAGACATTGTCTGGTCACCGTACGGACCAGAATGGCC
AATGCTAAGAAAAATCTGCATTAACAAAATGTTAAGCAACGCCACGTTGGATTCAAATTC
TTTTAGTGCACTTCGCCGCCAGGAGACCAGGCGAACAGTCCGGTATTTGGCAGACCGGGC
TCGGGCCGGGTTGGCGGTTAACGTTGGAGAACAAATATTTGTCACGATATTAAATGTGGT
GACTCAGATGTTGTGGGGAGAAACTGTTGCCGCCCTGTTCAGGATATATTCAATTGTAAA
TGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGA
AAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTA
TTATAAAATGAAAGTACATTTTGATAAAACGACAAATTACGATCCGTCGTATTTATAGGC
GAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTATTTCGACGTGTCTACATTC

Last Updated on 23.10.2014 13:25