SimpleSearch - Line and FST details


Line specific information

 
Line ID 393H03
Vector Used pAC161
Line Availability only available from NASC (N437719)
Segregation Analysis 50:49:39
Confirmed for Hit At4g12330
Parent of DUPLO pair none
Parent of pair(s) 7054, 10819, 94483, 94487, 94491, 94492

Gene hit At4g12330

 
Sequence (A. th genome BLAST matches underlined)
>24-K018292-022-393-H03-8409
TGATCTGAAATTTCCCGGACTGAAGCCTTTACATTGAATATATCCTGAACAGGGCGGCAA
CAGTTTCTCCCCACACATCTGAGTCACCACATTTAATATCGTGACAAATATTTGTTCTCC
AACGTTAACCGCCAACCCGGCCCGAGCCCGGTCTGCCAAATACCGGACTGTTCGCCTGGT
CTCCTGGCGGCGAAGTGCACTAAAAGAATTTGAATCCAACGTGGCGTTGCTTAACATTTT
GTTAATGCAGATTTTTCTTAGCATTGGCCATTCTGGTCCGTACGGTGACCAGACAATGTC
TACGCCACCATACGTGCTGAGTGAGCCTGCGACGGGAACGTCGTCGTTCGCAAAGATGAC
GTCATTAGTTCTTAGAATATCCCGCGTTGCTTCGGAAGAGGTTATCACGATGGTTAGTTT
TGCGCCGAGCCATAGTTTGAAAACGGGTCCGTGTTTTTGAGCTAGGGGGATGACTTCAAT
TTGGACCGGGGATCCCGCCACCCCCATGGCAAATAGCTAAAAGAGACGGATAATCTTACT
TCTGCGGTCCTTTCAAACGATGGGAATGAATATGAGAGCAAAATACGAAGCTGTCGACTA
ATAGCGCATAGAATGAGACGCGCGTAGCGGTCATTATAGCGCCTCCTTCTGAT
GenBank Accession BX286771 [GenBank]
Graphic View Graphic view of gene At4g12330
Predicted Position of Insertion Chr4:7319033 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T4C9
Hit Gene Code At4g12330 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation cytochrome P450, family 706, subfamily A, polypeptide 7
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40