Sequences from confirmation amplicon


Confirmation sequences for line 394B08 and hit At2g27050 are shown.
Line ID 394B08
Locus At2g27050 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr2:11547351
Primers used for PCR MM56 - 8474, show primer details
   
Sequence Name 51-K020131-022-394-B08C-MM56
GenBank Accession LN507360 [GenBank]
Sequencing primer gene specific primer, MM56: 5'-CCTTGTTGCATAAACATTTGATTG-3'
Sequence (A. th genome BLAST matches underlined)
>51-K020131-022-394-B08C-MM56
TTGAAATTCAGCTGCTGATTCTGAGCTGCTTTTGCATCAATGACCATGCTTTGGTTTTCC
ATCAAAGTAGGAGGCGTTTGGTTGCTTTGGACATTTCTGTCGTACATGGCCATAAGCTCG
GTGATCATCTTCTGCCCGTTTTCCGGAACTCCAACGCCCGATAGGTCGATCGGTTGGACT
GGTTGCTGAGGAACTACTAGTTTCATTCCACCCATATGAAACTTGGATGCTCCATACGCT
AAACGATTGTCTCTATATGGACAAACCATCTGGTGGTTGTCCCTTGAACTCCTGTCTTGA
AATCCAAGATTCATTTTGCTGTGAGGACACTGACCATTCTCACAAGTGTAACCTGCTGAT
CTGTCCATTACCATAACATTCATATCATTGTTCTGCTTCCTCTTTCTCGTGAACTCTAAG
TTTACCGTGGTGGCGACCTCCTCCTTTATGGGAAAATGTTGCATTTTAGCAACCCCAAAG
CTTGCTAGAGGATGCATCATCACTATCTCTGGTTTCCGCTCTGGTTTCAGCTGAATACTG
ATCCCGTTCAGGATATATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATC
AGCAATGAGTATGATGGTCAATATNGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTC
AATTCAAAAATG
   
Sequence Name 52-K020131-022-394-B08C-8409
GenBank Accession LN507678 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>52-K020131-022-394-B08C-8409
ATCCATGTAGATTTCCCGGACATGAAGCCATTTACAATTGAATATATCCTGAACGGGATC
AGTATTCAGCTGAAACCAGAGCGGAAACCAGAGATAGTGATGATGCATCCTCTAGCAAGC
TTTGGGGTTGCTAAAATGCAACATTTTCCCATAAAGGAGGAGGTCGCCACCACGGTAAAC
TTAGAGTTCACGAGAAAGAGGAAGCAGAACAATGATATGAATGTTATGGTAATGGACAGA
TCAGCAGGTTACACTTGTGAGAATGGTCAGTGTCCTCACAGCAAAATGAATCTTGGATTT
CAAGACAGGAGTTCAAGGGACAACCACCAGATGGTTTGTCCATATAGAGACAATCGTTTA
GCGTATGGAGCATCCAAGTTTCATATGGGTGGAATGAAACTAGTAGTTCCTCAGCAACCA
GTCCAACCGATCGACCTATCGGGCGTTGGAGTTCCGGAAAACGGGCAGAAGATGATCACC
GAGCTTATGGCCATGTACGACAGAAATGTCCAAAGCAACCAAACGCCTCCTACTTTGATG
GAAAACCAAAGCATGGTCATTGATGCAAAAGCAGCTCAGAATCAGCAGCTGAATTTCAAC
AGTGGCAATCAAATGT

Last Updated on 07.07.2016 14:16