SimpleSearch - Line and FST details


Line specific information

 
Line ID 394B08
Vector Used pAC161
Line Availability only available from NASC (N437748)
Segregation Analysis 100:98:71
Confirmed for Hit At2g27050
Parent of DUPLO pair none
Parent of pair(s) 9470

Gene hit At5g55300

 
Sequence (A. th genome BLAST matches underlined)
>58-K018293-022-394-B08-8409
GATCATGANATTNTCCGGACTGAAGCCTTTACAATTGAATATATCCTGAACGGGATCAGT
ATTCAGCTGAAACCAGAGCGGAAACCAGAGATAGTGATGATGCATCCCCTATGGGATCTT
CCCTATAGTGAGATCCCCTTGTACAGAACTTATTGCCATGACCGCTTGCATGGAAGAGGA
AATATAACACCGTGTGTGCACACTAGTAGATCATCTTCTTTTGTCCATCTCACGAGTAAG
GCGACCATTTTGAATACGCAGAACATTTGGACTCCTTCCTTACTTTCTTACTGTTTTTGG
TCATTGCTCTGGACCTA
GenBank Accession BX286804 [GenBank]
Graphic View Graphic view of gene At5g55300
Predicted Position of Insertion Chr5:22427780 - go to primer design
BLAST e Value 7e-15
Hit Clone Code (BAC ID) MCO15
Hit Gene Code At5g55300 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation DNA topoisomerase I alpha
Insertion Classification CDSi
Confirmation Status unknown

Gene hit At2g27050

 
Sequence (A. th genome BLAST matches underlined)
>58-K018297-022-394-B08-8409
TATCCTGAACGGGATCAGTATTCATCTGAAACCAGAGCGGAAACCAGAGATAGTGATGAT
GCATCCTCTATGGGATCCTCCCTATAGTGAGAGAGAAACAGACCGAGCATTACCAAGGCG
AATGCAATTCACAAATGTTGATAACCGGGGAGTTTTTATTTCATGATGGTCCACTTTCAG
ATCCACAAGGGGGATGATACGACAAATTTATGGGCCAATGCCATAATCAACCCATTCTAA
TTCGGAAATCTTTATTTCGACGTGTCTACATTCACGTCCAAATGGGGGCTTAGATGAGAA
ACTTCACGATCGATGCCTTGATTTCGCC
GenBank Accession FR809468 [GenBank]
Graphic View Graphic view of gene At2g27050
Predicted Position of Insertion Chr2:11547336 - go to primer design
BLAST e Value 7e-12
Hit Clone Code (BAC ID) T20P8
Hit Gene Code At2g27050 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation ETHYLENE-INSENSITIVE3-like 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03