Sequences from confirmation amplicon


Confirmation sequences for line 394E01 and hit At2g16640 are shown.
Line ID 394E01
Locus At2g16640 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr2:7212820
Primers used for PCR MG01 - 8474, show primer details
   
Sequence Name 25-K024136-022-394-E01C-MG01
GenBank Accession LN497272 [GenBank]
Sequencing primer gene specific primer, MG01: 5'-CCTGAATTCTGTTAAGGCTTTCAT-3'
Sequence (A. th genome BLAST matches underlined)
>25-K024136-022-394-E01C-MG01
CCACCTGACATTGTACTATATCTTGATAGGTTGGATATGCAAAGCAGAGATTCTGGTGAC
ATGCCTCTCCTGCGCACCATAAGTGATGTTTTTGGTCCTTCGATATGGTTTAATGCCATT
GTGGGTTTGACTCATGCCGCTTCTGTTCCACCAGATGGCCCAAATGGCACTGCTTCTAGC
TATGATATGTTTGTTACACAACGTTCTCATGTCATCCAGCAGGCCATTCGCCAAGCAGCT
GGAGATATGAGGCTCATGAACCCTGTTTCTTTAGTTGAGAATCACTCAGCTTGCAGGACT
AATCGGGCAGGCCAGAGAGTATGATGGATCAGCAATGAGTATGATGGTCAATATGGAGAA
AAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTAT
TATAAAATGAAAGTACATTTTGATAAAACGACAAATTACGATCCGTCGTATTTATAGGCG
AAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTATTTCGACGTGTCTACATTCACG
   
Sequence Name 26-K024136-022-394-E01C-8409
GenBank Accession LN497748 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>26-K024136-022-394-E01C-8409
TGATCCATCATACTCTCTGGCCTGCCCGATTAGTCCTGCAAGCTGAGTGATTCTCAACTA
AAGAAACAGGGTTCATGAGCCTCATATCTCCAGCTGCTTGGCGAATGGCCTGCTGGATGA
CATGAGAACGTTGTGTAACAAACATATCATAGCTAGAAGCAGTGCCATTTGGGCCATCTG
GTGGAACAGAAGCGGCATGAGTCAAACCCACAATGGCATTAAACCATATCGAAGGACCAA
AAACATCACTTATGGTGCGCAGGAGAGGCATGTCACCAGAATCTCTGCTTTGCATATCCA
ACCTATCAAGATATAGTACAATGTCAGGTGGATTCTTCTTGATGAAAGCCTTAACAGAAT
TCAG

Last Updated on 23.10.2014 13:25