SimpleSearch - Line and FST details


Line specific information

 
Line ID 394E01
Vector Used pAC161
Line Availability only available from NASC (N437777)
Segregation Analysis 50:48:43
Confirmed for Hit At2g16640
Parent of DUPLO pair 706
Parent of pair(s) none

Gene hit At2g16640

 
Sequence (A. th genome BLAST matches underlined)
>05-K018293-022-394-E01-8409
TATCATATCTAGAAGCAGTGCCATTTGGCGCCATCTGGTGGAACACCAATCGGCGTGACT
CGAACCCACGATGGCATTAAACCATATCGAACGACCAAAAACGTCACTAATAGTGCGCAG
GAGAGGCATGACACCATAATCTCTGCTTTGCATATCCGACCTATCACGATCTACCACCAT
GTCAGGTGGATTCTTCTTGATGAAAGCCTTAACAGAATTCACGATCTACACATTCTAGGC
TTGATCAGAGCAGGACCGANAGAGACCGGGAGTGTCAATCACCCGGACCTAAGTTCCCTG
AACACGACCCTCGTCATCTAGAACCCTCGATGACCCCATCAGGAATGCAGCAGGACATAA
TGTCACTGTCGTCAGATATGAAAGTGATCGCTGCACTTTTACCAACTCTACTTTTTCCGA
GAACCATAATCGCACAATATGAATCAGATGGATCCTGTCCAGCATCCTCAAGCTGTTCTG
CTATGGCACTAGCGCGATCAGGACTAAACGCGAGCCACTCGGGTTCGGTATCTGCACCTC
GGCTGCTAAGGCGATCCCGGCCCAGTGATACACCTGAGCAACAAAAACAATATGCGGGGT
GTGCCCTATGGATCCCCCCCCATAAGGAGGGAGGCGAATGGGCCCCTTAAAATGGCCAGC
TTCGTTAACCTTGGAAAGGGTAAATCAACTTCCCTA
GenBank Accession BX286844 [GenBank]
Graphic View Graphic view of gene At2g16640
Predicted Position of Insertion Chr2:7212870 - go to primer design
BLAST e Value 7e-129
Hit Clone Code (BAC ID) T24I21
Hit Gene Code At2g16640 [TAIR] [MIPS] [SIGnAL]
Gene Annotation multimeric translocon complex in the outer envelope membrane 132
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX286845 [GenBank]


Last Updated on 14.10.2014 10:23