Sequences from confirmation amplicon


Confirmation sequences for line 396F02 and hit At3g25560 are shown.
Line ID 396F02
Locus At3g25560 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr3:9282240
Primers used for PCR EQ44 - 8474, show primer details
   
Sequence Name 04-K103074-0022-396-F02C-8409
GenBank Accession LN487873 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>04-K103074-0022-396-F02C-8409
CATTTACCCAACACACACACACACACACACATATATGTAATCATGTGTTTACAGTTTTTA
CTATTGTGTGTATGTAGAGAAGCTCCAAGCCAAAACTTATCAGGAACTCTTTCATCAAGT
ATTGGAAATTTAACAAATCTTCAAACTGTGTAAGTATGTTTTGTAGTAATTATTAAAACA
TTGTTTCTTCATCTCTTAATCACTTTAGTTTTCTAATAATTTTGTTTGGAGATACAGGTT
ATTGCAGAACAATTACATAACAGGAAACATCCCTCATGAGATTGGGAAATTGATGAAACT
CAAAACACTTGATCTCTCTACCAATAACTTCACTGGTCAAATCCCATTCACTCTTTCTTA
CTCCAAAAATCTTCAGTACTTGTATGATTTTATCCATTTTTTCGTTTTGTTTATTTTATC
ATATTTTTTATATAAATTATTTATGGAGAGATTATTTTTGTGTTGAAAATTGTGGAGCAG
GAGGGTTAATAATAACAGCCTGACAGGAACAA
   
Sequence Name 03-K103074-0022-396-F02C-EQ44
GenBank Accession LN487442 [GenBank]
Sequencing primer gene specific primer, EQ44: 5'-AATTGTTCCTGTCAGGCTGTTATT-3'
Sequence (A. th genome BLAST matches underlined)
>03-K103074-0022-396-F02C-EQ44
CCATTTCACACAAATAATCTCTCCATAAATAATTTATATAAAAAATATGATAAAATAAAC
AAAACGAAAAAATGGATAAAATCATACAAGTACTGAAGATTTTTGGAGTAAGAAAGAGTG
AATGGGATTTGACCAGTGAAGTTATTGGTAGAGAGATCAAGTGTTTTGAGTTTCATCAAT
TTCCCAATCTCATGAGGGATGTTTCCTGTTATGTAATTGTTCTGCAATAACCTGTATCTC
CAAACAAAATTATTAGAAAACTAAAGTGATTAAGAGATGAAGAAACAATGTTTTAATAAT
TACTACAAAACATACTTACACAGTTTGAAGATTTGTTAAATTTCCAATACTTGATGAAAG
AGTTCCTGATAAGTTTTGGCTTGGAGCTTCTCTACATACACACAATAGTAAAAACTGTAA
ACACATGATTACATATATGTGTGTGTGTGTGTGTGTGTTGGTGTAAATGGCTTCATGTCC
GGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTA
ATTACCAATTTTTTTTCAATTCAAAAATGTAGATCTCCACAGCGTTATTA
Primers used for PCR 48wp - 3144, show primer details
   
Sequence Name 56-K118780-0022-396-F02C-48wp
GenBank Accession LN509248 [GenBank]
Sequencing primer gene specific primer, 48wp: 5'-AAACGAAGTCGAATTCTGGTAAGA-3'
Sequence (A. th genome BLAST matches underlined)
>56-K118780-0022-396-F02C-48wp
ATTTGTAGATACTTAATATAAATCAAGTTTTTTTTTTTGGGGGCCCAAAGTATATAACCC
ATAAAAATCTTATAAAATTCGGTTTTTTTCCCCAGGATGGAAAACTAAACTTTCCCCAAT
TTTGCCCCGGGCCTTTCCCAGTTTACGGCCTAAAGGACCTTTAAATAAATAATGGGCAAA
CAAATCTTTCCCTTTCCCTTCCCCCCTTAAACTCCCACCCACAAATCCTCCCAAACCAAA
ACCCCCGGTCCCATCTTTTTCTAAAAACCCCCCAAACAAAAAACCAAAAAAAAAAATTTT
TCTTATCCAAAAAAAATAACCCCCAAACTCGGCCCCTAAAAAATAAAAACCCCCAAAAAA
AACAATTTTTAATCCGAACAAAAATTTTCCAGGGAAAAAAAAAACCAAAAAAAAGTTAGG
CTTGGTCCCCTCCAACTTCCTCCTCCTCCTTAACCGGTTTCCTTCCTCCTCCTCCGGCAA
AACTCAAAAACAAGGGGGTAACCTTTAAAGGAAAGGTTCATCAAAAAAATCTCCCCCCAC
TTCTAATTTCCCCCTTTTTCCTCCCAAAAACAGGCTTTCCTTTTTTGGTTCCTCCTTAAG
TGGTGCCCTAAAAAGAAACCAAAACCTCACGGACGGACCCCCAGGGAGTTCAAAGAAATG
GGAATAACACACCATTTAACCCATGTACCTGGAACATAAACACGGATGTTTAAACCCAAA
GGCGGAAAACAACAATCTAATCCCCGGGAACCCTGTCCTCTCCAAATAAAAGGAACTCCC
TAATATAAAGAAGGGGCCTTGCAAAGGAAAGGGGAATT
   
Sequence Name 16-K118779-0022-396-F02C-35St
GenBank Accession LN493640 [GenBank]
Sequencing primer T-DNA primer, 35St: 5'-GTGGATTGATGTGATATCTCC-3'
Sequence (A. th genome BLAST matches underlined)
>16-K118779-0022-396-F02C-35St
TCCACTATCCTTCGCAGACCCTTCCTCTATATAGGAAGTTCATTTCATTTGGAGAGGACA
GGGTACCCGGGGATCAGATTGTCGTTTCCCGCCTTCGGTTTAAACTATCAGTGTTCATGT
TCCAGCTACATGGATCAACTGCTGTGTCATCCCAATTCATTAGAACTCCATGAGGATCAG
TCAGTGAGCTTTTGATTCCTATTAAGGCAACAACTAAAGAAGAAACAAAAAAAGAAAAGC
ATGTTTTAGGAAGAAAAAAGGAGAAACTGAGAAGTGGGGGAAGATTTTGTTGATGAACAT
TACCTTCAAAGTTAACACCTTTGTCTGTGAGTTCTGCAGAAGAAGAAGAAAGAAAACAGA
TAAAGAAGAAGAAGAAAGTTGAAGAGAACAAAGCATAACTCTTTTTTGCTTCTCTTCTTC
CTTGCAACATCTTTGTCCGAATCAAAACTTGTTTTTCTTGAGAGTATTAATCTCTAAGGT
GCAGAGTTTGAGGTTTATTTCTTTTGTATAAGAAATATTCTTTTTTTCGATTCTTTGTTT
GGAGGTTTTTAAGAAAAAGATGGAACAGAGGATTTTGATTTGGAAGTATTTGTGAGTGAG
AGTTAAAGAGGGAAAGAGAAAGAGAAAGATTTGTCTGCCAATTATTTATCTAATGGTCCT
CTAGACTGTAAACTGGAAAAGGCCAGAGACAAAATCGGGAAATGTTTAGTTTTCAATCAT
GTGATAAAAAAACAGAATTCTATAAGATTTTTATGGTTTATATACTTCGCGCACACAAAA
AAAAAAACTTGATTTATATAAAGTTATCTACAAATATGGGCCCTTT

Last Updated on 23.10.2014 13:25