SimpleSearch - Line and FST details


Line specific information

 
Line ID 396F02
Vector Used pAC161
Line Availability only available from NASC (N437982)
Segregation Analysis 50:49:46
Confirmed for Hit At3g25560
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g25560

 
Sequence (A. th genome BLAST matches underlined)
>16-K118779-0022-396-F02C-35St
TCCACTATCCTTCGCAGACCCTTCCTCTATATAGGAAGTTCATTTCATTTGGAGAGGACA
GGGTACCCGGGGATCAGATTGTCGTTTCCCGCCTTCGGTTTAAACTATCAGTGTTCATGT
TCCAGCTACATGGATCAACTGCTGTGTCATCCCAATTCATTAGAACTCCATGAGGATCAG
TCAGTGAGCTTTTGATTCCTATTAAGGCAACAACTAAAGAAGAAACAAAAAAAGAAAAGC
ATGTTTTAGGAAGAAAAAAGGAGAAACTGAGAAGTGGGGGAAGATTTTGTTGATGAACAT
TACCTTCAAAGTTAACACCTTTGTCTGTGAGTTCTGCAGAAGAAGAAGAAAGAAAACAGA
TAAAGAAGAAGAAGAAAGTTGAAGAGAACAAAGCATAACTCTTTTTTGCTTCTCTTCTTC
CTTGCAACATCTTTGTCCGAATCAAAACTTGTTTTTCTTGAGAGTATTAATCTCTAAGGT
GCAGAGTTTGAGGTTTATTTCTTTTGTATAAGAAATATTCTTTTTTTCGATTCTTTGTTT
GGAGGTTTTTAAGAAAAAGATGGAACAGAGGATTTTGATTTGGAAGTATTTGTGAGTGAG
AGTTAAAGAGGGAAAGAGAAAGAGAAAGATTTGTCTGCCAATTATTTATCTAATGGTCCT
CTAGACTGTAAACTGGAAAAGGCCAGAGACAAAATCGGGAAATGTTTAGTTTTCAATCAT
GTGATAAAAAAACAGAATTCTATAAGATTTTTATGGTTTATATACTTCGCGCACACAAAA
AAAAAAACTTGATTTATATAAAGTTATCTACAAATATGGGCCCTTT
GenBank Accession HG968953 [GenBank]
Graphic View Graphic view of gene At3g25560
Predicted Position of Insertion Chr3:9282240 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) MWL2
Hit Gene Code At3g25560 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation NSP-interacting kinase 2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX287057 [GenBank] BX287057 [GenBank]

Gene hit T16I18

 
Sequence (A. th genome BLAST matches underlined)
>14-K018299-022-396-F02-8409
TGATCTGAAATTTCCNGGACATGAAGCCTTTACATTGAATATATCCTGAATAAACAATTG
GTAATTACTCTTTCTTCTCTTCAGCGTTTATTAAAGAAAATTGTACATGTCCTCTATTTT
AAGGTTTCTTGGAACGAATTGAGCGGGTAAAGAAGGCGTGATATTAATAGCATCATAAAG
TACAGATACTTGATACTTGGTAGCTATGGGATCCTCCCCCTAGTGGGGAGAAGTAAAGTG
CATGGTGACGGTGTTCGGCATTCTGAATCTCACCGAGGACTCCTTCTTCGATGAGAGCCG
GCGGCTATGGGATCCCCCCTATAGTGAG
GenBank Accession FR809524 [GenBank]
Graphic View Graphic view of sequence FR809524 of line 396F02
Predicted Position of Insertion Chr4:15818916 - go to primer design
BLAST e Value 3e-29
Hit Clone Code (BAC ID) T16I18
Insertion Classification Genome Hit
Confirmation Status unknown


Last Updated on 31.08.2016 09:40