Sequences from confirmation amplicon


Confirmation sequences for line 400B05 and hit At1g18750 are shown.
Line ID 400B05
Locus At1g18750 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:6467645
Primers used for PCR TM03 - 8474, show primer details
   
Sequence Name 23-K021337-022-400-B05C-8409
GenBank Accession LN496380 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>23-K021337-022-400-B05C-8409
TAGATTTCCCGGACATGAAGCCATTTACAGTTTAGAAGATCACAGATAAGGGGTATTTAC
AATTGAATATTTAGTTTGGGAGCTTTTGGCTTTGGGAGAGATTAGAGACTCTAAAACAGA
GCCTAGTTTTTTTTTTATAGTTTCCTTTCTGTTATCAGTTCTTAGATAATGTTCTTCGTG
AGTGATTTGGCTTCCTGAATCTCTCAGAGGGATGAGAGATTGAGGTTCTGTATTCAAGTT
TTTAGCAATATACTGATTTTAGTCTTAACTTGGCTTTTGTGTAGTTGCATTGAAGAGGTT
ATTTCCAAGTTTGCGCAATTAACTCCACAAGAAAGGACAAAAAGGTATGGTAAGCATTAT
GTTGAAAATTTAAATTACTATCAATCCTGATGTAATTTTGTGTTATGAACCTAAATTGAA
GTCTCTTTCTTTTAATATTACAGGAAACTGGAGAGCCTTGAAGTAAAGACATAAAAACTC
ACTGTGTATATCATCAACTTTTGTTTTTTTTTGAAACACAAA
   
Sequence Name 24-K021337-022-400-B05C-TM03
GenBank Accession LN496822 [GenBank]
Sequencing primer gene specific primer, TM03: 5'-AATCAGCTCAAATTTGTGTTTCAA-3'
Sequence (A. th genome BLAST matches underlined)
>24-K021337-022-400-B05C-TM03
CAAAAGTTGATGATATACACAGTGAGTTTTTATGTCTTTACTTCAAGGCTCTCCAGTTTC
CTGTAATATTAAAAGAAAGAGACTTCAATTTAGGTTCATAACACAAAATTACATCAGGAT
TGATAGTAATTTAAATTTTCAACATAATGCTTACCATACCTTTTTGTCCTTTCTTGTGGA
GTTAATTGCGCAAACTTGGAAATAACCTCTTCAATGCAACTACACAAAAGCCAAGTTAAG
ACTAAAATCAGTATATTGCTAAAAACTTGAATACAGAACCTCAATCTCTCATCCCTCTGA
GAGATTCAGGAAGCCAAATCACTCACGAAGAACATTATCTAAGAACTGATAACAGAAAGG
AAACTATAAAAAAAAAACTAGGCTCTGTTTTAGAGTCTCTAATCTCTCCCAAAGCCAAAA
GCTCCCAAACTAAATATTCAATTGTAAATACCCCTTATCTGTGATCTTCTAAACTGTAAA
TGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGA
AAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCA

Last Updated on 07.07.2016 14:16