Sequences from confirmation amplicon


Confirmation sequences for line 401D07 and hit At5g62500 are shown.
Line ID 401D07
Locus At5g62500 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr5:25095087
Primers used for PCR SF02 - 8474, show primer details
   
Sequence Name 03-K023835-022-401-D07C-8409
GenBank Accession LN487312 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>03-K023835-022-401-D07C-8409
GATTTCCCGGACATGAAGCCATTTACTCAAACATCCTCTCCAAGTGATTCTATCTTCTAA
GACAAGGCAATGGATCATTGTTGCCCTCTACTTTTATTTGTCACAACTTTAAGTTTGGGT
CTCTGCAGCAGCTGCTGCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCCTCCTCTTTTCC
TTCTTCTTCATAACCCTCAAGCCCTAGAGACTGGTTTAGGCACTCTTGAGCTTCTTCTAG
CACAGATTCATTTGCATCGGTTGCGTATAATATCTTCTTAACCGCTACCACTATCTGCAC
ACATTGTGGTTTCAACAAAATCATATATGGTTTGAGTTCAAACTAAGAAAAACAAAGACA
GCATATCAACAACAAAAATGATGACATTTACCGGAAGATCATCGAGTTCAGGAGTCTGAC
ATAGTATCTCTATATCCCGGAGCTTAGAGAAGTAAAAATCTCTTTCTTTTTCCAAGAGAT
CAACCGAGACCTTGAGATCTTCTACCTGGTATTGTGAAAAGAAAATTTCATTATAAGTCT
ATCTTCATTAACAAGAAGAAAAGAAT
   
Sequence Name 07-K023835-022-401-D07C-SF02
GenBank Accession LN489086 [GenBank]
Sequencing primer gene specific primer, SF02: 5'-CATTCGGTTTCATTCTTTTCTTCT-3'
Sequence (A. th genome BLAST matches underlined)
>07-K023835-022-401-D07C-SF02
ATGAAGATAGACTTATAATGAAATTTTCTTTTCACAATACCAGGTAGAAGATCTCAAGGT
CTCGGTTGATCTCTTGGAAAAAGAAAGAGATTTTTACTTCTCTAAGCTCCGGGATATAGA
GATACTATGTCAGACTCCTGAACTCGATGATCTTCCGGTAAATGTCATCATTTTTGTTGT
TGATATGCTGTCTTTGTTTTTCTTAGTTTGAACTCAAACCATATATGATTTTGTTGAAAC
CACAATGTGTGCAGATAGTGGTAGCGGTTAAGAAGATATTATACGCAACCGATGCAAATG
AATCTGTGCTAGAAGAAGCTCAAGAGTGCCTAAACCAGTCTCTAGGGCTTGAGGGTTATG
AAGAAGAAGGAAAAGAGGAGGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGCAGCAGCTG
CTGCAGAGACCCAAACTTAAAGTTGTGACAAATAAAAGTAGAGGGCAACAATGATCCATT
GCCTTGTCTTAGAAGATAGAATCACTTGGAGAGGATGTTTGAGTAAATGGCTTCATGTCC
GGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTA
ATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAA
GTACATTTTGATAAAACGACAAATTACGATCCGTCGTATTT

Last Updated on 23.10.2014 13:25