SimpleSearch - Line and FST details


Line specific information

 
Line ID 401D07
Vector Used pAC161
Line Availability only available from NASC (N438443)
Segregation Analysis 50:46:35
Confirmed for Hit At5g62500
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g62500

 
Sequence (A. th genome BLAST matches underlined)
>52-K018291-022-401-D07-8409
GATCATGAGATTTCCCGGACATGNAGCCATTTACTCAACATCCTCTCCAAGTGATTCTAT
CTTCTAAGACAAGGCAATGGATCATTGTTGCCCTCTACTTTTATTTGTCACAACTTTAAG
TTTGGGTCTCTGCAGCAGCTGCTGCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCCTCCT
CTTTTCCTTCTTCTTCATAACCCTCAAGCCCTATGGGATCCTCCCTATAGTGAGANGNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAANNAAAANNNNNNNNNNANNNNNA
NAAAAAAAAAAAAAAANNAAGAAAAAAAAAAAAAAAAANAAAAAANAAAAANAAAAAAAA
AAAANAAAAAAAAAAAAAAAAAAAAAAAGAAAANANNAAAAAAAANGGNAAANNNNAGGN
ANNAAAAGAAAAATAAAAAAAAAAAANNNGAAAAANGAAACCAGAGAAAAGGAAAANGAG
AGGGAAAAGGGGGANGGGGGAAGAGGAAAAGGAGAAGGAAAGAAGAGGAAAAAAAAGGAG
AGGAAAAGAGAAAGGGGGGGAGAGAGGAGAAAAAGGGGAGAAAAAAGGGGGAGGGAGGAG
AAGAGAAGAAAAAAAAAAAGAGAGGGAAGAGAGGAAGAAAGAGAAAAGGGCGAGANGGCA
GGNAGAAAAAAAAAAAAAAAAAAGCGGGCGGCGGCAGAAGACGAANACAGAAAAAGCGCG
CCGCGCACCGCAAAAGAAAAGAAAAAACGGAAGAGAGGGAACAGAAGGAAGGACGAAGGA
ACAGGGGCGCGGCGGGACACAGGGAAAACGCAGAAAAAGAGAAGAGCGGCAGGACAAAAA
ACAAACAAGGA
GenBank Accession BX287425 [GenBank]
Graphic View Graphic view of gene At5g62500
Predicted Position of Insertion Chr5:25095085 - go to primer design
BLAST e Value 3e-54
Hit Clone Code (BAC ID) K19B1
Hit Gene Code At5g62500 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation end binding protein 1B
Insertion Classification TS2TE (3')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX287424 [GenBank]


Last Updated on 07.07.2016 14:03