Sequences from confirmation amplicon


Confirmation sequences for line 401H02 and hit At2g31900 are shown.
Line ID 401H02
Locus At2g31900 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr2:13566399
Primers used for PCR AS21 - 8474, show primer details
   
Sequence Name 01-K023618-022-401-H02C-8409
GenBank Accession LN486408 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>01-K023618-022-401-H02C-8409
TAGATTTCCCGGACATGAAGCCATTTACAATTGAATATATCCTGAAATGGCTTAAATCGA
AGGCGGGAAACGACAATTGAACTCTTTTGTGATCTAAGCCATTTATGGTGTGATGTTGGA
CATGAAGGATTATGTTGACGTACAAGCTTTGCTAGATGCATCTAAGTGCTCTTTTGTCGC
CAATTTGTTTCCACCACTTCCAGAAGACGCATCAAAGCAGTCCAAATTTTCATCCATAGG
GACCCGTTTCAAGGTAAGCCACTAGTAAGTATATCATTTGCACATTGCTCAAGATCTTGA
TTCCTGACCTAACCTACCCCCAGCAACAACTCCAAGCTCTAATGGAGACGCTGAACACAA
CAGAGCCCCATTATATTAGATGTGTGAAACCAAATGCAGTTCTGAAGCCCGGAATTTTTG
AGAACGACAACGTCCTAAACCAACTAAGATGCGGAGTAAGCCTAAAGCCTCAGGTTTCCT
AGTTAAACAAGTTCATGTTTTCCCACCAGGATATTTACTAATACCGTATCTGGATAAGTG
AACAGGGTGTACTGGAAGCTATAAGAATCAGTTGTGCTGGTTATCCAACGAAACGAGCTT
TCGATGAATTCCTAGATCGTTTTGTGATGCTAGCAACAGACGTTCCAGAGGGGTAAAAAT
ACTCAATAAATAAAAATCTAGAACACAGGTTATTAGTTGTATGCTATTATCCTGATCCAA
TCAACATTGAGAAAATTACATTATCTA
   
Sequence Name 02-K023618-022-401-H02C-AS21
GenBank Accession LN486863 [GenBank]
Sequencing primer gene specific primer, AS21: 5'-TTCGTCGGATCTGTCAATAGATAA-3'
Sequence (A. th genome BLAST matches underlined)
>02-K023618-022-401-H02C-AS21
AATTTTCTCAATGTTGATTGGATCAGGATAATAGCATACAACTAATAACCTGTGTTCTAG
ATTTTTATTTATTGAGTATTTTTACCCCTCTGGAACGTCTGTTGCTAGCATCACAAAACG
ATCTAGGAATTCATCGAAAGCTCGTTTCGTTGGATAACCAGCACAACTGATTCTTATAGC
TTCCAGTACACCCTGTTCACTTATCCAGATACGGTATTAGTAAATATCCTGGTGGGAAAA
CATGAACTTGTTTAACTAGGAAACCTGAGGCTTTAGGCTTACTCCGCATCTTAGTTGGTT
TAGGACGTTGTCGTTCTCAAAAATTCCGGGCTTCAGAACTGCATTTGGTTTCACACATCT
AATATAATGGGGCTCTGTTGTGTTCAGCGTCTCCATTAGAGCTTGGAGTTGTTGCTGGGG
GTAGGTTAGGTCAGGAATCAAGATCTTGAGCAATGTGCAAATGATATACTTACTAGTGGC
TTACCTTGAAACGGGTCCCTATGGATGAAAATTTGGACTGCTTTGATGCGTCTTCTGGAA
GTGGTGGAAACAAATTGGCGACAAAAGAGCACTTAGATGCATCTAGCANAGCTTGTACGT
CAACATAATCCTTCATGTCCAACATCACACCATAAATGGCTTAGATCACAAAAGAGTTCA
ATTGTCGTTTCCCGCCTTCGATTTAAGCCATTTCAGGATATATTCAATTGTAAATGGCTT
CATGTCCGGGAAATCTACATGGATCAGCAATGAG

Last Updated on 07.07.2016 14:16