SimpleSearch - Line and FST details


Line specific information

 
Line ID 401H02
Vector Used pAC161
Line Availability only available from NASC (N438486)
Segregation Analysis 50:50:50
Confirmed for Hit At2g31900
Parent of DUPLO pair none
Parent of pair(s) 5086, 5088, 5168, 5178, 83588, 83599, 83604, 83605, 83606, 83607, 83608

Gene hit At2g31900

 
Sequence (A. th genome BLAST matches underlined)
>16-K018290-022-401-H02-8409
TGATCTGAAATTTCCCGGACATGAAGCCTTTACATTGAATATATCCCGAGATGGCTTATA
TGCCAACGCGAGAAACGACATGGAACTCTTTTGTGATACTAAACCGTTAATGGCGTGTAT
GTTGGACATCGAAAGATTATCTTGCACATACAATCTTTGCTATGGAAGCTGGCCTAAAGA
GAGATAATAAGTTTTAAAGAGTTTTATGCAGAAAAAGCGCCTTTTTTCTCTTTGATATCA
CTCACTTACATGAGAGACACGCCTCCCAATGTGACGGCTTTGGGTTCCCAATGTAAGGGT
TCCGGTTCCCAATGGAAGGATTTGGGCTCCCAATGTACGCGCTATCCACAGGAAAGAGAC
CTTTTCGACCTTTTTCCCCTGCTATGGGATCCTCCCCTATAGTGAGACANCTCTNAAGCC
CGGAATTTTTGAGAACGACCACCTCCTAAACCGACTAAGATGCGGAGTAAGCCTAAAGCC
TCGTGTTTCCTAGTTAAACAAGTTCATGTTTTCCCACCAGGATATTTACTAATACCGTAG
CTGGATGAGTGAACAGGGTGTACTGGAAGCTATAAGAATCAGTTGTGCTGGTTATCCCAC
GAAACGAGCTTTCGATGAATTCCTAGATCGTTTTGTGATG
GenBank Accession FR809627 [GenBank]
Graphic View Graphic view of gene At2g31900
Predicted Position of Insertion Chr2:13566494 - go to primer design
BLAST e Value 1e-105
Hit Clone Code (BAC ID) F20M17
Hit Gene Code At2g31900 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation myosin-like protein XIF
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX287482 [GenBank]


Last Updated on 31.08.2016 09:40