Sequences from confirmation amplicon


Confirmation sequences for line 403G12 and hit At5g66420 are shown.
Line ID 403G12
Locus At5g66420 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr5:26522787
Primers used for PCR HM62 - 8474, show primer details
   
Sequence Name 45-K101219-0022-403-G12C-8409
GenBank Accession LN505461 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>45-K101219-0022-403-G12C-8409
GCCATTTACATTGAAGCCGACTGCATTGGCATCAGCAAATGGAAGTAAGCCTGCTAAGGA
TCCTCTTCCAGCCATACGAAAACGTCCAGAGTTGTATATCACTATCAAATCAATCCCACC
AGCTTCCTCAAACTTTGCAGATATTCCAGTACCAGCACCTCCCCCAATTATTGGTATTCC
CTTCTCTATTTGATCTCTCAACCGTCCCAAAATGGCCTGAGTTCGTTCCAAGGTTTCTGG
AGCCAGTGATGATAATAAGTTTTTTAATTCCAACATGCAAGTTCCGTATCCAAATACTAG
AACTACCAATTGATCTGGTCGTTAGTTTAAGGTAAGTGGGAAGCAAAAGGAAACCTGGCT
TTGCATTGGGAAACTCTTTAGGACTGTATGGAATCCTTTCAAGCCTCGATCTCACATGTC
CATCATCATGCTCTCCAGTACTAGGTTTAGTCGAAGTCGTTTCAGAGGGTTTGATTTGTG
CGAAAGTTTT
   
Sequence Name 45-K101226-0022-403-G12C-HM62
GenBank Accession LN505462 [GenBank]
Sequencing primer gene specific primer, HM62: 5'-AAAAACTTACGCACAAATCAAACC-3'
Sequence (A. th genome BLAST matches underlined)
>45-K101226-0022-403-G12C-HM62
TGGAGAGCATGATGATGGACATGTGAGATCGAGGCTTGAAAGGATTCCATACAGTCCTAA
AGAGTTTCCCAATGCAAAGCCAGGTTTCCTTTTGCTTCCCACTTACCTTAAACTAACGAC
CAGATCAATTGGTAGTTCTAGTATTTGGATACGGAACTTGCATGTTGGAATTAAAAAACT
TATTATCATCACTGGCTCCAGAAACCTTGGAACGAACTCAGGCCATTTTGGGACGGTTGA
GAGATCAAATAGAGAAGGGAATACCAATAATTGGGGGAGGTGCTGGTACTGGAATATCTG
CAAAGTTTGAGGAAGCTGGTGGGATTGATTTGATAGTGATATACAACTCTGGACGTTTTC
GTATGGCTGGAAGAGGATCCTTAGCAGGCTTACTTCCATTTGCTGATGCCAATGCAGTCG
TGCTTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGA
TGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCANAAATGTAA
ATGTCCGCA

Last Updated on 07.07.2016 14:16