SimpleSearch - Line and FST details


Line specific information

 
Line ID 403G12
Vector Used pAC161
Line Availability only available from NASC (N438676)
Segregation Analysis 50:49:37
Confirmed for Hit At5g66420
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g66420

 
Sequence (A. th genome BLAST matches underlined)
>95-K017818-022-403-G12-8409
TGTCCTGTAGATTTCCCGGACATGAAGCCATTTATACTTGAAGCACGACTGCATTGGCAT
CAGCAAATGGAAGTAAGCCTGCTAAGGATCCTCTTCCAGCCATACGAAAACGTCCAGAGT
TGTATATCACTATCAAATCAATCCCACCAGCTTCCTCAAACTTTGCAGATATTCCAGGAC
CAGCACCTCCCCCAATTATTGGTATTCCCTTCTCTATTTGATCTCTCAACCGTCCCAAAA
TGGCCTGAGTTCGTTCCAAGGTTTCTGGAGCCAGTGATGATAATAAGTTTTTTAATTCCA
ACATGCAAGTTCCGTATCCAAATACTATGGGATCCTCCCCTATAGTGAGAGTATACGATA
CCCTCCCTACTGTGGTGTGCTAAACTGAATTAGCAGCTCTATGGGAGACTCTATATACAG
AGTGAGACTGGATCGGTAGCTCGAGGAAGGGCGTGTATGTATACAATATAGGCGAAGCCG
CGAATAGATTGCGGCTAGGCCAAAAATCTTTTGTAGGACGGGTGGAAATTAAACTTCCAA
AGGGGGGGCTAAAAAGAAAAAACTTTCAAATAGAGGGCGTAAATTCACACATTGTGAAGG
GCCTCCCCCGGAGGTCCGCAACCAAGAAGGAGGGGGAATTGAGTGGTGATCTCGCCCAAG
AGAGGGGAGGGACACACATAAGATAGTGAAATATACGGCGGCGGGCGCGAAAGGGCGAAN
AGACACCCCTCAAAAGGAAGCAAAAANCAGCGGAAATTGCGTGTGGGAANCCCNACACCC
GCCGCGCGAGCCCATCTNTCAANAATAATATCGATTAAAATAAAA
GenBank Accession BX287683 [GenBank]
Graphic View Graphic view of gene At5g66420
Predicted Position of Insertion Chr5:26522787 - go to primer design
BLAST e Value 1e-158
Hit Clone Code (BAC ID) K1F13
Hit Gene Code At5g66420 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation TIM-barrel signal transduction protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03