Sequences from confirmation amplicon


Confirmation sequences for line 404D04 and hit At4g33230 are shown.
Line ID 404D04
Locus At4g33230 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr4:16028959
Primers used for PCR MH18 - 8474, show primer details
   
Sequence Name 27-K019284-022-404-D04C-MH18
GenBank Accession LN498178 [GenBank]
Sequencing primer gene specific primer, MH18: 5'-TATTCTGGCAAGTTGGTTTGTAGA-3'
Sequence (A. th genome BLAST matches underlined)
>27-K019284-022-404-D04C-MH18
AATTGCAAAGTGTTTGGATAATCTTATCGACCTGGCCAGCTTTCACAGTTTGTGCTGCGG
ATGATGGCGGTTTCGGGCTCGGGCTCTCGCTTTTGGTGGGGCTATCCTTACTTTTGTTGT
TTGTAGTTTTCCCTTGTTCTTGAGTTTTGTTTTCATATGTAACATAAGCAAAAGCACCTC
CAATAATGGCAGCAGCAACAACAAGCACGGAGACGACTCCTAAGATGATTCTCTTCCTGA
ATTTACGTTTTCTCTCTGCATTTACGCGTTCTTGAATCTTGTCGAAGTCTTGAAAAGCCA
TTTTTGCTTAAAACTTTTTCTCTGTCTTTTTGTCACTTTGAGAGAAGAAAATTGAATTTT
CCTCTGCCTTAGAAGCAAGCTAAGGCAGGGAGGTTAAAATGGAAGAAGATCAGACTTTCT
ATTTTTTCTTGTGATTATTTATTTTCCTCTGTTTTGATTGATGCATATTGTTTTGAGCCA
ATTTCACGCCTTCTAAGTTTAGCTTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACA
TGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGCAATTACCAATTTT
TTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGAT
AAAACGACAAATTACGATCCGTCTTATTTATAGGCGAAAGCAATAAACAAATTATTCTAA
TTCGGAAATCTTTATT
   
Sequence Name 23-K019284-022-404-D04C-8409
GenBank Accession LN496366 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>23-K019284-022-404-D04C-8409
GTAGATTTCCCGGACATGAAGCCATTTACAATTGAAGCTAAACTTAGAAGGCGTGAAATT
GGCTCAAAACAATATGCATCAATCAAAACAGAGGAAAATAAATAAACACAAGAAAAAATA
GAAAGACTGATCTTCTTCCATTTTAACCTCCCTGCCTTAGCTTGCTTCTAAGGCAGAGGA
AAATTCAATTTTCTTCTCTCAAAGTGACAAAAAGACAGAGAAAAAGTTTTAAGCAAAAAT
GGCTTTTCAAGACTTCGACAAGATTCAAGAACGCGTAAATGCAGAGAGAAAACGTAAATT
CAGGAAGAGAATCATCTTAGGAGTCGTCTCCGTGCTTGTTGTTGCTGCTGCCATTATTGG
AGGTGCTTTTGCTTATGTTACATATGAAAACAAAACTCAAGAACAAGGGAAAACTACAAA
CAACAAAAGTAAGGATAGCCCCACCAAAAGCGAGAGCCCGAGCCCGAAACCGCCATCATC
CGCAGCACAAACTGTGAAAGCTGGCCAGGTCGATAAGATTATCCAAACACTTTGCAATTC
TACTCTCTACAA

Last Updated on 23.10.2014 13:25