SimpleSearch - Line and FST details


Line specific information

 
Line ID 404D04
Vector Used pAC161
Line Availability only available from NASC (N438728)
Segregation Analysis 100:100:95
Confirmed for Hit At4g33230
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit F23N19

 
Sequence (A. th genome BLAST matches underlined)
>28-K017865-022-404-D04-8409
ATTATGTTGCAATGACTTTTGGTTAGAGTTCTTGTTGTGGTTGTTTTGTGGTTCGTGTCT
ATGGGATCATCCCTATAGTGAGAGAAAANGAANCAGTACTTTCCAATTTTTTTTCAATTC
AAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGACAA
ATTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATC
TTTATTTCGACGTGTCTACATTCACGTCCAAATGGGGGCTTAGATGAGAAACTTCACGAT
CGATGCCTTGATTCCGCCATTCCCA
GenBank Accession BX287742 [GenBank]
Graphic View Graphic view of sequence BX287742 of line 404D04
Predicted Position of Insertion Chr1:23263300 - go to primer design
BLAST e Value 3e-26
Hit Clone Code (BAC ID) F23N19
Insertion Classification Genome Hit
Confirmation Status unknown

Gene hit At4g33230

 
Sequence (A. th genome BLAST matches underlined)
>28-K017819-022-404-D04-8409
GCCTAATAATGAGTCGCCATGTAAAATAAAATCAAAAGAATGAGTCGGCCCATTTCAAGG
ACTCACTTACCTATGGGATCCTCCCTATAGTGAGAGTGAGTCTCTGACTTTGACTATGGG
ATCCTCCCTATAGAGAGAAAGTTTTAAGCAAAGATGGCTTTTCAAGACTTCGACAAGATT
CAAGAACGCGTAAATGCACAGAGAAAACGTAAATTCAGGAAGAGAATCATCTTAGGAGTC
GTCTCCGTGCTTGTTGTTGCTGCTGCCATTATTGGAGGTGCTTTTGCTTATGTTACATAT
GAAAACAAAACTCAAGAACAAGGGAAAACTACAAACAACAAAAGTAAGGATAGCCCCACC
AAAAGCGAGAGCCCGAGCCCGAAACCGCCATCATCCGCAGCACAAACTGTGAAAGCTGGC
CAGGTCGATAAGATTATCCAAACACTTTGCAATTCTACTCTCTACAAAACCACTTGCCAG
AATACTCCTTAAAATGAGACAAAGAAAGATACTCCTTCAACTGATCCTATGGGATCCTCC
CTATAGTGAG
GenBank Accession BX287741 [GenBank]
Graphic View Graphic view of gene At4g33230
Predicted Position of Insertion Chr4:16028941 - go to primer design
BLAST e Value 2e-86
Hit Clone Code (BAC ID) F4I10
Hit Gene Code At4g33230 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Plant invertase/pectin methylesterase inhibitor superfamily
Insertion Classification 5' region
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23