Sequences from confirmation amplicon


Confirmation sequences for line 405H09 and hit At1g20490 are shown.
Line ID 405H09
Locus At1g20490 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:7099115
Primers used for PCR EK03 - 8474, show primer details
   
Sequence Name 67-K021739-022-405-H09C-8409
GenBank Accession LN511721 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>67-K021739-022-405-H09C-8409
AGCCATTTACAACGAGTGGTCAACGAGTCAGAGACCGAGTCAACCAGGACGACACGGCGA
TGATGCTTTACTCGTCGGGAACCACAGGGACGAGCAAAGGAGTGATCTCGTCTCACCGGA
ATTTAACAGCTTACGTTGCGAAATACATCGACGATAAATGGAAACGAGACGAGATATTCG
TATGTACCGTGCCGATGTTCCACTCCTTCGGGTTATTGGCGTTCGCAATGGGCTCCGTAG
CATCGGGTTCAACGGTGGTGATTCTCCGGAGATTCGGGCTCGACGATATGATGCAAGCGG
TGGAGAAGTACAAAGCCACGATTCTGAGTTTGGCTCCACCGGTTTTGGTAGCTATGATTA
ACGGTGCAGATCAGCTCAAGGCCAAGTACGATTTGACCTCCCTGAGAAAGGTTAGGTGTG
GTGGAGCACCGTTGAGCAAGGAGGTTATGGATAGCTTCCTAGAGAAATATCCAACGGTTA
ATATTTTTCAAGGATATGCGTTGACTGAGTCGCACGGTTCAGGAGCTTCGACGGAATCTG
TGGAGGAGAGTCTGAAATACGGTGCGGTTGGGTTGTTGTCGTCCGGTATTGAAGCGAGGA
TTGTGGATCCGGATACGGGTCGGGTCATGGGTGTGAACCAACCCGGTGAGCTCTGGCTCA
AGGGTCCTTCTATTTCTAAAGGTAAACAAACACTAATAAACGCTAAATATTTGGCAATAA
TTAGATTATTTGAAATAGACATTTTATTATTGGGAAATTATTTATAAAACAAATATTATG
ATCAAGTTTTTAAGCAGT
   
Sequence Name 68-K021739-022-405-H09C-EK03
GenBank Accession LN511919 [GenBank]
Sequencing primer gene specific primer, EK03: 5'-ATCCAAAACCCATTTTACTGCTTA-3'
Sequence (A. th genome BLAST matches underlined)
>68-K021739-022-405-H09C-EK03
TTTGTTTATAATAATTTCCCAATAATAAAATGTCTATTTCAATAATCTAATTATTGCCAA
ATATTTAGCGTTTATTAGTGTTTGTTTACCTTTAGAAATAGAAGGACCCTTGAGCCAGAG
CTCACCGGGTTGGTTCACACCCATGACCCGACCCGTATCCGGATCCACAATCCTCGCTTC
AATACCGGACGACAACAACCCAACCGCACCGTATTTCAGACTCTCCTCCACAGATTCCGT
CGAAGCTCCTGAACCGTGCGACTCAGTCAACGCATATCCTTGAAAAATATTAACCGTTGG
ATATTTCTCTAGGAAGCTATCCATAACCTCCTTGCTCAACGGTGCTCCACCACACCTAAC
CTTTCTCAGGGAGGTCAAATCGTACTTGGCCTTGAGCTGATCTGCACCGTTAATCATAGC
TACCAAAACCGGTGGAGCCAAACTCAGAATCGTGGCTTTGTACTTCTCCACCGCTTGCAT
CATATCGTCGAGCCCGAATCTCCGGAGAATCACCACCGTTGAACCCGATGCTACGGAGCC
CATTGCGAACGCCAATAACCCGAAGGAGTGGAACATCGGCACGGTACATACGAATATCTC
GTCTCGTTTCCATTTATCGTCGATGTATTTCGCAACGTAAGCTGTTAAATTCCGGTGAGA
CGAGATCACTCCTTTGCTCGTCCCTGTGGTTCCCGACGAGTAAAGCATCATCGCCGTGTC
GTCCTGGTTGACTCGGTCTCTGACTCGTTGACCACTCGTTGTAAATGGCTTCATGTCCGG
GAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAANAAGAAAGAGTAAT
TACCAATTTTTTTTCAATTCANAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGT
ACATTTTGATAAAACGACNAATTACGATCCG

Last Updated on 07.07.2016 14:16