SimpleSearch - Line and FST details


Line specific information

 
Line ID 405H09
Vector Used pAC161
Line Availability only available from NASC (N438877)
Segregation Analysis 100:99:81
Confirmed for Hit At1g20490
Parent of DUPLO pair none
Parent of pair(s) 88761

Gene hit At1g20490

 
Sequence (A. th genome BLAST matches underlined)
>72-K017820-022-405-H09-8409
GATCCTGAGATTTCCCGGACATGAAGCCATTTACAATTGAATATATCCTGAGCGACTTAC
TTAGTTCCCTATGGGATCCTCCCTATAGTGAGACCTCGGGAGCCTCCCCATGGAGGAGTT
TTGGCGTGATCTCGTCTCACGCGGAATTTAACAGCTTACGTTGCGAAATACATCGACGAT
AAATGGAAACGAGACGAGATATTCGTATGTACCGTGCCGATGTTCCACTCCTTCGGGTTA
TTGGCGTTCGCAATGGGCTCCGTAGCATCGGGTTCAACGGTGGTGATTCTCCGGAGATTC
GGGCTCGACGATATGATGCAAGCGGTGGAGAAGTACAAAGCCACGATTCTGAGTTTGGCT
CCACCGGTTTTGGTAGCTATGATTAACGGTGCAGATCAGCTCAAGGCCAAGTACGATTTG
ACCTCCCTGAGAAAGGTTAGGTGTGGTGGAGCACCGTTGAGCAAGGAGGTTATGGATAGC
TTCCTATGGGATCCTCCC
GenBank Accession BX287902 [GenBank]
Graphic View Graphic view of gene At1g20490
Predicted Position of Insertion Chr1:7099091 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F5M15
Hit Gene Code At1g20490 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation AMP-dependent synthetase and ligase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40