Sequences from confirmation amplicon


Confirmation sequences for line 410D09 and hit At3g05840 are shown.
Line ID 410D09
Locus At3g05840 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr3:1740866
Primers used for PCR JC06 - 8474, show primer details
   
Sequence Name 37-K024509-022-410-D09C-8409
GenBank Accession LN502473 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>37-K024509-022-410-D09C-8409
GTAGATTTCCCGGACATGAAGCCATTTACAATTGAATCTATCAGCATCAGTAACGTTTCC
AGTAGATTCTCTAACCGCGGCACTAGGCTCTATGCCCACCGAGGCCATCCCAAGATTAAA
ACAGAAGAATTTGTTTTAATAAAAGATTCTTCCTTTGTCACGCTCTTCAAATCTGTCAAT
CAGAGATTAAAAAACTCAATCCTGCAGCAACATTAACCATAAGCAAAGTAAGCGTTAGCT
CTTGATTCATAAACCATACATATGTAATTACAATTACTTGGTTGTTACAAGACAATCAGT
TTAACTGAGGCAATTACACAGATTTGAAACTCAATAAAGGTGATCCCAGAACTCATATTG
AAGCTATCAACATGCAAAAGTTTGGATTTTAACGAGACATTTAAAACAATTATCACGAAA
AAAAAAGCAGGAGACAGCCAAAAAATTTAAAATTATAGCATCCTAAATAAGAAAAAAATC
ATGGAACAATCCATAGAGGATAGCAAATTTCAACACAAACAACAAAAGATAAGAGATGTT
AAAAACACAGAGCATTGAGAAATCTATCTATCTCATATTGGCCAATAAACAAATCTAGGC
CGATCTAAACAGAGGAAAAATC
   
Sequence Name 38-K024509-022-410-D09C-JC06
GenBank Accession LN502848 [GenBank]
Sequencing primer gene specific primer, JC06: 5'-TCCGATTTCATGTTAGATTTTTCC-3'
Sequence (A. th genome BLAST matches underlined)
>38-K024509-022-410-D09C-JC06
TCTGTTAGATCGGCCTAGATTTGTTTATTGGCCAATATGAGATAGATAGATTTCTCAATG
CTCTGTGTTTTTAACATCTCTTATCTTTTGTTGTTTGTGTTGAAATTTGCTATCCTCTAT
GGATTGTTCCATGATTTTTTTCTTATTTAGGATGCTATAATTTTAAATTTTTTGGCTGTC
TCCTGCTTTTTTTTTCGTGATAATTGTTTTAAATGTCTCGTTAAAATCCAAACTTTTGCA
TGTTGATAGCTTCAATATGAGTTCTGGGATCACCTTTATTGAGTTTCAAATCTGTGTAAT
TGCCTCAGTTAAACTGATTGTCTTGTAACAACCAAGTAATTGTAATTACATATGTATGGT
TTATGAATCAAGAGCTAACGCTTACTTTGCTTATGGTTAATGTTGCTGCAGGATTGAGTT
TTTTAATCTCTGATTGACAGATTTGAAGAGCGTGACAAAGGAAGAATCTTTTATTAAAAC
AAATTCTTCTGTTTTAATCTTGGGATGGCCTCGGTGGGCATAGAGCCTAGTGCCGCGGTT
AGAGAATCTACTGGAAACGTTACTGATGCTGATAGATTCAATTGTAAATGGCTTCATGTC
CGGGAAATCTACATGGATCAGCAATNGAGTATGATGGTCAATATGGAGAAAAAGAAAGAG
TAATTACCAATTTTTTTTTCA

Last Updated on 07.07.2016 14:16