SimpleSearch - Line and FST details


Line specific information

 
Line ID 410D09
Vector Used pAC161
Line Availability only available from NASC (N439309)
Segregation Analysis 50:50:36
Confirmed for Hit At3g05840
Parent of DUPLO pair none
Parent of pair(s) 84629, 84636, 84640, 84647, 84648, 84649, 84650, 84651, 84652

Gene hit At3g05840

 
Sequence (A. th genome BLAST matches underlined)
>68-K017999-022-410-D09-8409
TGATCTGTAGATCCCNGGACATGAGCATTTACAATTGAATCTATCAGCATCAGTAACGTT
TCCAGTAGATTCTCTAACCGCGGCACTATGGGATCCTCCCTATAGTGAGAGAATTTGNCN
GTTTATCTCAATGTACTTTCATTTTATAATAACGCTGCGGACATCTACATTTTTGAATTG
AAAAAAAATTGGTAATTACTCTTTCTTTTTCTCCATATTGACCATCATACTGCATTGCTG
ATCCATGTATATTTCCCGGACATGAAGCCATTTTCAATCGAATCTATC
GenBank Accession BX288211 [GenBank]
Graphic View Graphic view of gene At3g05840
Predicted Position of Insertion Chr3:1740866 - go to primer design
BLAST e Value 3e-20
Hit Clone Code (BAC ID) F10A16
Hit Gene Code At3g05840 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Protein kinase superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40