Sequences from confirmation amplicon


Confirmation sequences for line 410E06 and hit At1g65730 are shown.
Line ID 410E06
Locus At1g65730 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:24442820
Primers used for PCR CC03 - 8474, show primer details
   
Sequence Name 43-K022913-022-410-E06C-8409
GenBank Accession LN504699 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>43-K022913-022-410-E06C-8409
CCATGTAGATTTCCCGGACATGAAGCCATTTACAATTGAATATATCATTGTGGTGATGAA
ACTGAATCTAACGACTGGGATTATTCCGTCGCTGAATATCTCCGCCGGTTTGCTTGGTTT
CTTCTTTGTTAAAAGTTGGACTAAGATTCTTAATAAAGCTGGTTTTCTTAAACAACCGTT
TACACGGCAAGAGAATACTGTGATTCAGACTTGTGTCGTCGCCTCCTCCGGCATCGCCTT
TAGCGGTACGTTTTTTTGTTTGTTGATGTGAACGCGTCGATGGAATTTGGTGTCGCCGTC
TTTAATTTTGTTTCTATTTACGGCTAAAACTTTTTTGCTGTTAGGTCTCTATTGAAAATG
ACAGAGTATATACTTCTTTTTTGTGTTTATCGCTTTCTAAAAAAAAATATGAAAATTAAA
TAAACTATATAGTTGTTTAAAAAATATAATATGTGCAATAGTTAAAAAATTAAAACCGAT
CAAGTTAAAACCTAGACTAGGAAACTAATATCACACGATCTTTTTTGATAAAAATAAATG
TGTATGGGTTTGATA
   
Sequence Name 47-K022913-022-410-E06C-CC03
GenBank Accession LN506063 [GenBank]
Sequencing primer gene specific primer, CC03: 5'-ACTGCAAAGAAGTATCAAACCCAT-3'
Sequence (A. th genome BLAST matches underlined)
>47-K022913-022-410-E06C-CC03
ACATTTATTTTTATCAAAAAAGATCGTGTGATATTAGTTTCCTAGTCTAGGTTTTAACTT
GATCGGTTTTAATTTTTTAACTATTGCACATATTATATTTTTTAAACAACTATATAGTTT
ATTTAATTTTCATATTTTTTTTTAGAAAGCGATAAACACAAAAAAGAAGTATATACTCTG
TCATTTTCAATAGAGACCTAACAGCAAAAAAGTTTTAGCCGTAAATAGAAACAAAATTAA
AGACGGCGACACCAAATTCCATCGACGCGTTCACATCAACAAACAAAAAAACGTACCGCT
AAAGGCGATGCCGGAGGAGGCGACGACACAAGTCTGAATCACAGTATTCTCTTGCCGTGT
AAACGGTTGTTTAAGAAAACCAGCTTTATTAAGAATCTTAGTCCAACTTTTAACAAAGAA
GAAACCAAGCAAACCGGCGGAGATATTCAGCGACGGAATAATCCCAGTCGTTAGATTCAG
TTTCATCACCACAATGATATATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATG
GATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTT
TTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAA
AACGACAAATTACGATCCGTCGTATTT

Last Updated on 23.10.2014 13:25