SimpleSearch - Line and FST details


Line specific information

 
Line ID 410E06
Vector Used pAC161
Line Availability only available from NASC (N439318)
Segregation Analysis 100:96:85
Confirmed for Hit At1g65730
Parent of DUPLO pair none
Parent of pair(s) 65587, 95737, 95738, 95739, 95740, 95741, 95742

Gene hit At1g65730

 
Sequence (A. th genome BLAST matches underlined)
>45-K017999-022-410-E06-8409
TGATCTGAGATTTTCCGGACTGAAGCCATTTACATTGAATATATACCGCCACCCCTATGG
GATGCCTCCCTATCGTGAGATAATTGAGCGCGTTTAAAATCCTCCGTATTTAATGGGGCC
TGCTTTGGTTTAACCCTTCCTACATTTGTATGTAGCATCGGGACCTCTTGGATAACCCTT
TGGACTGCTTGAGATTACTGGGGATACATGATTTTTGCTCTAGCCCCCTCCGGTCTCAGC
TTCTGACGACGGATCTTCTTTCCGTTGATATGACTTGGCTCATCTAGTTCGATTACGGCA
TCTTCCCTATAGTGAGAATTTACGGCTAAAACTTTTTTGCTGTTAGGTCTCTATTGAAAA
TGACAGAGTATATACTTCTTTTTTGTGTTTATCGCTTTCTAAAAAAAAATATGAAAATTA
AATAAACTATATAGTTGTTTAAAAAATATAATATGTGCAATAGTTAACAAATTAAAACCG
ATCAAGTTAAAACCTATGGGATCCTCCCTTATAGTGAGACGTGCTCGACACCGCCGCAAT
AAGAGCCGCTTCCTTCGCGGAGGAAGAGAGAGCAAGAGTTTGACTA
GenBank Accession BX288218 [GenBank]
Graphic View Graphic view of gene At1g65730
Predicted Position of Insertion Chr1:24442829 - go to primer design
BLAST e Value 2e-39
Hit Clone Code (BAC ID) F1E22
Hit Gene Code At1g65730 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation YELLOW STRIPE like 7
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03