Sequences from confirmation amplicon


Confirmation sequences for line 411D02 and hit At1g03900 are shown.
Line ID 411D02
Locus At1g03900 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:993063
Primers used for PCR NE32 - 8474, show primer details
   
Sequence Name 64-K102433-0022-411-D02C-8409
GenBank Accession LN511168 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>64-K102433-0022-411-D02C-8409
TATCGATATGTACAACGATGATTATAAGGAAGAAAAATAATTAAAACAGGGAGTGTGGGA
GGATTACAAAGAAACACACATCAACTTACCATTAACATACATCAAAAAGACTGTTGGCTG
ACCACCATTGTTGTCTATTGTCTCGTGCTCTCAAGTCACAAGAAGATGAAGCCGGACTTG
TCCAATAACTTAAATTTTACACTCCATTCATCAGAAAGCTGCCCAACCTGATGCAGCTCC
TGTTGACTTGCTCGATCCTGATCCCGCCGTTGAAGGAAGATTTTTCTGCCGAGTATTACC
AAATCAAGGATAATTTAGAGTAACCTTAGAGAATAAGAATAAATGTAATTAAGAAGACAA
GGTTTATTTACCTTGAGCTGAGATAGATCAGATAGAGGCTCGTTCCTGCGTGATTCCTTG
CAGCCATCAGATGCAATCCTTGAAGCGACGGGATCGTTTGGAGGAGGAGGTAAAGGAGAC
CTGGTTACTCCGGCAGCTTTGGGGGGTGGGGCAAGTGCTAGAGGTTTTGGCTTCCCCGTT
CCTGAAAGAGCAGCTGAGAGCATCCCAGTGCCATTTGTTGTTGGTTTCGGCTTCACGTTG
ATTCTTATGGTTTCACCTTCCTTAAAACCCATCAAA
   
Sequence Name 64-K102434-0022-411-D02C-NE32
GenBank Accession LN511169 [GenBank]
Sequencing primer gene specific primer, NE32: 5'-GAAAAGATTGTTGTTTTGATGGGT-3'
Sequence (A. th genome BLAST matches underlined)
>64-K102434-0022-411-D02C-NE32
CATAGATCACGTGAGCCGAACCAACAACAAATGGCACTGGGATGCTCTCAGCTGCTCTTT
CAGGAACGGGGAAGCCAAAACCTCTAGCACTTGCCCCACCCCCCAAAGCTGCCGGAGTAA
CCAGGTCTCCTTTACCTCCTCCTCCAAACGATCCCGTCGCTTCAAGGATTGCATCTGATG
GCTGCAAGGAATCACGCAGGAACGAGCCTCTATCTGATCTATCTCAGCTCAAGGTAAATA
AACCTTGTCTTCTTAATTACATTTATTCTTATTCTCTAAGGTTACTCTAAATTATCCTTG
ATTTGGTAATACTCGGCAGAAAAATCTTCCTTCAACGGCGGGATCAGGATCGAGCAAGTC
AACAGGAGCTGCATCAGGTTGGGCAGCTTTCTGATGAATGGAGTGTAAAATTTAAGTTAT
TGGACAAGTCCGGCTTCATCTTCTTGTGACTTGAGAGCACGAGACAATAGACAACAATGG
TGGTCAGCCAACAGTCTTTTTGATGTATGTTAATGGTAAGTTGATGTGTGTTTCTTTGTA
ATCCTCCCACACTCCCTGTTTTAATTATTTTTCTTCCTTATAATCATCGTTGTTACATTA
TCGATTAACATGGGTAAAACTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAA
AAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTAT
TATAAAATGAAAGTACATTTTGATAAAACGACAAATTACGATCCGTCGTATTTATAGGCG
AAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTATTTCGACGTGTCTACATTCC

Last Updated on 07.07.2016 14:16