SimpleSearch - Line and FST details


Line specific information

 
Line ID 411D02
Vector Used pAC161
Line Availability only available from NASC (N439398)
Segregation Analysis 50:49:40
Confirmed for Hit At1g03900
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g03900

 
Sequence (A. th genome BLAST matches underlined)
>12-K017996-022-411-D02-8409
TGCAAGTGTCGTTTTGTTCTATTGGAAATATGATTATTGTTATAACAGAAAGTATGACCC
GCCATTCTTCAAAATCATCTTTTCTTCTTTAAAAACCTTTTTCCCGCTCGGGGCCCCTCC
CTAAAGGGAGATGATGCCTACTCTTTCTCTTTCTGCTTTCTCCCCTTCGACATCCTTACT
TTCCCGAGCAAATGGCGGCTTATATGAGAAACTTCTCAATCGATGCCTTGATTTCGCCAT
TCCATTTCTGCCGAAAATTACCAAATCATGGATACTTTACAGTAACCTTATATTATAAGA
GTTCATGTTCTTACCAAGACGGGGGTTATTTACCGAAGAACTGAGATAGATCGGCTTGAG
GTTCCCCTCCTGCGAGATTCCTTGCAGCCATCAGATGCAATCCTTGAAGCGACCGGATCG
TTTGGAGGATGAGGTAAAGGAGACCTGGTTACTCCGGCAGCTTTGGGGGGTGGGGCCAGT
GCTATGGGATCCTCCCTATAGTGAG
GenBank Accession BX288268 [GenBank]
Graphic View Graphic view of gene At1g03900
Predicted Position of Insertion Chr1:993033 - go to primer design
BLAST e Value 4e-50
Hit Clone Code (BAC ID) F21M11
Hit Gene Code At1g03900 [TAIR] [MIPS] [SIGnAL]
Gene Annotation non-intrinsic ABC protein 4
Insertion Classification TS2TE (3')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23