Sequences from confirmation amplicon


Confirmation sequences for line 415G03 and hit At3g10030 are shown.
Line ID 415G03
Locus At3g10030 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr3:3094822
Primers used for PCR RZ21 - 8474, show primer details
   
Sequence Name 53-K023492-022-415-G03C-8409
GenBank Accession LN508019 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>53-K023492-022-415-G03C-8409
GTAGATTTCCCGGACATGAAGCCATTTACGACGCCATTAAAAATGCCGTTAGGGTTACGG
CGGTGGTAGCAACCAGAGACGGCGTTAATTAGCGGCGAGAGGCTGAAGAAACGGAAGGAG
AAGGCGTCAAGGCGTGAACTAGCGCAAAAGTGGATGGGCCGTCACAACGGCTCCGTTAGG
CAAGTGGTAAGGGTGGAATAAAAAAAAGTTAATTCACAAAAACCAAACCGAACCAAAGTT
AAATTGCGTTATTCTATTCGGTTTTGGTTAATCCAAACCGAAACATAGTTAAATTCGCTT
CCGTTACAGTCAATAACCTACGTTACCTCATATTTTTCAG
   
Sequence Name 54-K023492-022-415-G03C-RZ21
GenBank Accession LN508349 [GenBank]
Sequencing primer gene specific primer, RZ21: 5'-TTGTTGGAAAGCTGAAAAATATGA-3'
Sequence (A. th genome BLAST matches underlined)
>54-K023492-022-415-G03C-RZ21
GTAACGTAGTTATTGACTGTAACGGAAGCGAATTTAACTATGTTTCGGTTTGGATTAACC
AAAACCGAATAGAATAACGCAATTTAACTTTGGTTCGGTTTGGTTTTTGTGAATTAACTT
TTTTTTATTCCACCCTTACCACTTGCCTAACGGAGCCGTTGTGACGGCCCATCCACTTTT
GCGCTAGTTCACGCCTTGACGCCTTCTCCTTCCGTTTCTTCAGCCTCTCGCCGCTAATTA
ACGCCGTCTCTGGTTGCTACCACCGCCGTAACCCTAACGGCATTTTTAATGGCGTCGTAA
ATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAG
AAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTT
ATTATAAAATGAAAGTACATTTTGATAAAACGACAAATTACGATCCGTCGTATTTATAGG
CGAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTATTTCGACGTGTCTACATTC

Last Updated on 23.10.2014 13:25