SimpleSearch - Line and FST details


Line specific information

 
Line ID 415G03
Vector Used pAC161
Line Availability only available from NASC (N439819)
Segregation Analysis 50:49:47
Confirmed for Hit At3g10030
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g10030

 
Sequence (A. th genome BLAST matches underlined)
>23-K018044-022-415-G03-8409
TATCATGTAGATTTCCCGAACATGAAGCCATTTACGACACCTTAACAATGCCGTTATGCG
TCTACTGGCGGTGGTAGCAACCAGAGACGGCGTTAATTATCGGTGAGAGGCTGAAGAAAC
GGAAGGAGAAGGCGTCAAGGCGTGAACTATGGGATCCTCCCTATAGTGAGATACATTTTT
GAATTGAAAAAAAATGGGTAATTACTCTTTCTTTTTCTCCATATTGACCATCATACTCAT
TGCTGATCCATGTACATTTCCCGAGGATGGCTTCAATTACAACCTTCTTAATCATTGCGT
TAATTTCA
GenBank Accession BX288491 [GenBank]
Graphic View Graphic view of gene At3g10030
Predicted Position of Insertion Chr3:3094845 - go to primer design
BLAST e Value 1e-34
Hit Clone Code (BAC ID) T22K18
Hit Gene Code At3g10030 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation aspartate/glutamate/uridylate kinase family protein
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At1g48090

 
Sequence (A. th genome BLAST matches underlined)
>23-K026166-022-415-G03-8409
TTGCATTTACGAATCCTTACGCAAAGATATTGTGGCTTAGAGATTACCCCCAAAAAAGTA
TGATAATAATGTGGCTCTGTTGGTACTTCCCATTTNCCACCTCATCATCAATAGCTTACC
CGGGTTTGGGGGAACTGATTTCACTTTACCCAAAAACCAAATTTCAGGAGGTTAAATTGT
CTAAATTTTGAACACAAAACTCGCTTTAGCGTGTACCCATCCAAACCATATAATGGTTCC
AGCCCTACTAATAATATCACATACAGCCAGTATCAAAAACGGCGTCATATTTCCGCGTAC
AATTACAACAAATGCTCACTTTTATTATTATACCAATGATACTCTGGGGAGTGATAAAGA
TAATCATTATTTGTTATTAATAA
GenBank Accession CR397276 [GenBank]
Graphic View Graphic view of gene At1g48090
Predicted Position of Insertion Chr1:17748798 - go to primer design
BLAST e Value 3e-31
Hit Clone Code (BAC ID) T2J15
Hit Gene Code At1g48090 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation calcium-dependent lipid-binding family protein
Insertion Classification CDSi
Confirmation Status unknown
Other FSTs Supporting this Hit CR397276 [GenBank]


Last Updated on 31.08.2016 09:40