Sequences from confirmation amplicon


Confirmation sequences for line 417A08 and hit At2g40220 are shown.
Line ID 417A08
Locus At2g40220 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr2:16796858
Primers used for PCR MM62 - 8474, show primer details
   
Sequence Name 36-K020358-022-417-A08C-8409
GenBank Accession LN502049 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>36-K020358-022-417-A08C-8409
CCATGTAGATTTCCCGGACATGAAGCCATTTACAATTGAAGGAACAAGGAGGAAGTGGGT
GTAATAATAATAGTTCGATGGAGGATTTGAACTCTCTAGCTGGTTCGGTGGGTTCGAGTC
TATCAATAACTCATCCACCGCCGTTGGTTGATCCGGTATGTTCTATGGGTCTGGATCCGG
GTTATATGGTTGGAGATGGATCTTCGACCATTTGGCCTTTTGGAGGAGAAGAAGAATATA
GTCATAATTGGGGGAGTATTTGGGATTTTATTGATCCCATCTTGGGGGAATTCTATTAAT
TTGTTTTTGTGGAAGATCATATTATATACGATGAGCATCCCTAAGGTCGGTCAAGAGCAT
TGGAGATTCATTGTTGAGAGGAATCAAAGAGATT
   
Sequence Name 40-K020358-022-417-A08C-MM62
GenBank Accession LN503558 [GenBank]
Sequencing primer gene specific primer, MM62: 5'-GCAATCTCTTTGATTCCTCTCAAC-3'
Sequence (A. th genome BLAST matches underlined)
>40-K020358-022-417-A08C-MM62
AATCTCCAATGCTCTTGACCGACCTTAGGGATGCTCATCGTATATAATATGATCTTCCAC
AAAAACAAATTAATAGAATTCCCCCAAGATGGGATCAATAAAATCCCAAATACTCCCCCA
ATTATGACTATATTCTTCTTCTCCTCCAAAAGGCCAAATGGTCGAAGATCCATCTCCAAC
CATATAACCCGGATCCAGACCCATAGAACATACCGGATCAACCAACGGCGGTGGATGAGT
TATTGATAGACTCGAACCCACCGAACCAGCTAGAGAGTTCAAATCCTCCATCGAACTATT
ATTATTACACCCACTTCCTCCTTGTTCCTTCAATTGTAAATGGCTTCATGTCCGGGAAAT
CTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCA
ATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATT
TTGATAAAACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTAT
TCTAATTCGGAAATCTTTATTTCGACGTGTCTACATTCA

Last Updated on 23.10.2014 13:25