SimpleSearch - Line and FST details


Line specific information

 
Line ID 417A08
Vector Used pAC161
Line Availability only available from NASC (N439944)
Segregation Analysis 53:48:44
Confirmed for Hit At2g40220
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g08690

 
Sequence (A. th genome BLAST matches underlined)
>57-K026069-022-417-A08-8409
NNNTTTAGAGCTATTCGGACATGAGCCTTTACATTGAATATATCCTGTACGTGTAGTGGC
CTCGAATGAGGATCATTCCTAGTCTGTGCCCACAACATCTTTCGACTCAGACGGTGAAGA
CACTCGATTTTATGAATATCTGCGCAATGATGGCGATGCACTCTCCCACTTGAGGAGTGC
CATCTCCTGCATCATAATATGGTGACTATTTTCCTGTACGGAACTAAGAAAAAGAAAGGA
GTATACTTCATAGCACATAATTAATATCAACTTGTGCGACTGCTGGAGCAGGTAATTATG
GCATCCTCCCTATAGTGAGAATCCTCCCTATACTGAGAATCAGTGCCTTTGTCCATGAGA
GATTCAAGTATCCGCACGGATTGTCTCCAATCATGACATCTCTTGAGGATCACGATCATC
CCACAAGGCTGGTGCTTGAGGTGTCTCATCATTTGAATCAAAATGTCGTTACCACCATTG
CTATGGATAGCATGCAATCCTC
GenBank Accession CR397301 [GenBank]
Graphic View Graphic view of gene At5g08690
Predicted Position of Insertion Chr5:2825726 - go to primer design
BLAST e Value 5e-39
Hit Clone Code (BAC ID) T2K12
Hit Gene Code At5g08690 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation ATP synthase alpha/beta family protein
Insertion Classification TS2TE (5')
Confirmation Status unknown

Gene hit At2g40220

 
Sequence (A. th genome BLAST matches underlined)
>57-K018040-022-417-A08-8409
TGATCTGTAGATTTCCNGGACATGATGCATTTACAATTGAAGGAACAAGGAGGAAGTGGG
TGTAATAATAATCAGTTCGATGGAGGATTTGAACTCTCTATGGGATCCTCCCTATAGTGA
GACGATGGGAACCCCCCTATTACGAGTTTATGTGAACCTCCCTATGTCGAGCTCCCCTGA
ATTGTAAAAAACTGATAGTACCTCTTTCTATATCCACTAATTAGACACTCCCCCTAATTG
TTGGCCCATGCAATAAACCCGGACTTTAAGCCGGAAACCTTTATATGCAACAGTCTGCAT
TGACGGCCAAATGGGGGCTTAGATGAGAAACTTCACGATGGATGCCGATCACTCCACCTT
TCGAGAGGCTCCCCACCCGGGGATAGGGAAGGACCCGCACTTGACCACCAGCCGAAAAAA
CGGCATCGTAGCCCGGGGGGCGAACAGACCCTGGGGGGGACCACCACGGCCCCCCCCTCT
ATATGAAAGAAGGGGCAGAAAGACCAGGCAAATACCCATGACACGCGAAGCCGCGCCGAC
TACGGGGCCCGGGCGAGGTGCACGAGGACATATGGAACCTCTCTGGGCTGCGGGGGAGGA
GCGCACACCCGGCCGGGCGGGGCCACACCAACCCCGCGAAAGAAAGGGCGGGGGGGAGCA
CACCGGCAAAACCAGACAGAG
GenBank Accession BX288553 [GenBank]
Graphic View Graphic view of gene At2g40220
Predicted Position of Insertion Chr2:16796858 - go to primer design
BLAST e Value 7e-21
Hit Clone Code (BAC ID) T7M7
Hit Gene Code At2g40220 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Integrase-type DNA-binding superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03