Sequences from confirmation amplicon


Confirmation sequences for line 418B02 and hit At1g28520 are shown.
Line ID 418B02
Locus At1g28520 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:10031184
Primers used for PCR MS73 - 8474, show primer details
   
Sequence Name 27-K022565-022-418-B02C-8409
GenBank Accession LN498200 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>27-K022565-022-418-B02C-8409
TAGATTTCCCGGACATGAAGCCATTTACAAGGCACAAGCATCACACTTGTTGATCTCATA
TTCGTAAAGATGCCATTCGAAATGGTGCAGAGGCTGTGGATCCATGTAGTAAGATCTCTT
CAGCCCTCCAAACTCGACCATGATCTGTTTACGTGACTCGTGCCAACCACGACCATTGTA
GTCTGGTAAAGATCTTTGCTTTCTGTTCCCGCTCTCAAAGGCCCTCCTTGGCTTGTCAAA
GAATAGCCACTCCCTTAGTGTCTCACTCTCCAGAACCGTGAGATCAAAGAGCTCTACAGT
CATCAAGATTTGAGTATGATCAGCTCAAGAATGGT
   
Sequence Name 28-K022565-022-418-B02C-MS73
GenBank Accession LN498670 [GenBank]
Sequencing primer gene specific primer, MS73: 5'-TAATTGATCACCATTCTTGAGCTG-3'
Sequence (A. th genome BLAST matches underlined)
>28-K022565-022-418-B02C-MS73
ATACTCAAATCTTGATGACTGTAGAGCTCTTTGATCTCACGGTTCTGGAGAGTGAGACAC
TAAGGGAGTGGCTATTCTTTGACAAGCCAAGGAGGGCCTTTGAGAGCGGGAACAGAAAGC
AAAGATCTTTACCAGACTACAATGGTCGTGGTTGGCACGAGTCACGTAAACAGATCATGG
TCGAGTTTGGAGGGCTGAAGAGATCTTACTACATGGATCCACAGCCTCTGCACCATTTCG
AATGGCATCTTTACGAATATGAGATCAACAAGTGTGATGCTTGTGCCTTGTAAATGGCTT
CATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGA
AAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAA
AATGAAAGTACATTTTGATAAAACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGC
AATAAACAAATTATTCTAATTCGGAAATCTTTATTTCGACGTGTCTACATTCACG

Last Updated on 07.07.2016 14:16