SimpleSearch - Line and FST details


Line specific information

 
Line ID 418B02
Vector Used pAC161
Line Availability only available from NASC (N440046)
Segregation Analysis 100:98:97
Confirmed for Hit At1g28520
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g28520

 
Sequence (A. th genome BLAST matches underlined)
>10-K018138-022-418-B02-8409
TTTCCCGGACTGAAGCCATTTAAAGGCACAAGCATCACACTTGTTGATCTCATATTCGTA
AAGATGCCATTCGAAATGGTGCAGAGGCTGTGGATCCATGTAGTAAGATCTCTTCAGCCC
TCCAAACTCGACCATGATCTGTTTACGTGACTCGTGCCAACCACGACCATTGTAGTCTGG
TAAAGATCTTTGCTTTCTGTTCCCGCTCTCAAAGGCCCTCCTTGGCTTGTCAAAGAATAG
CCACTCCCTTAGTGTCTCACTCTCCAGAACCGTGAGATCAAAGAGCTCTACAGTCATCAA
GATTTGAGTATGATCAGCTCAAGAATGGTGATCAATTAACATACTTGTGAATGAATTCCA
AGAGAGTAAAGCCTACCTGGAGCATTCCATGGAGATTTAGCAGTTGCAGCTCCTTCACAT
TCGGGAATACCAACATCTTTCCCTCCAGCCTTTGCACTAAGAGCAGCANAAAGCAGACCG
TCTTTTAGGCCGATACCTCCAGGACGCACCACCGGATTCATACCTGGTGGCCCTTCATTG
AAAGCCAGTGCAGCGTGGAAGCTGCTGCAGTAATCCTGGAACCAATCAAATCCCTGAGCT
GGCCTAT
GenBank Accession BX288603 [GenBank]
Graphic View Graphic view of gene At1g28520
Predicted Position of Insertion Chr1:10031181 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F3M18
Hit Gene Code At1g28520 [TAIR] [MIPS] [SIGnAL]
Gene Annotation vascular plant one zinc finger protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit K18B18

 
Sequence (A. th genome BLAST matches underlined)
>10-K018099-022-418-B02-8409
ATTCCCGGACTGAAGCCTTTACATTGAATACTCATTGAGTATTTGAGAAAGGTTAAACGT
TAATGTTTTTGATTTATTTACTCACCCTGAAAAATGTATCAGAAAGTCAAAAACAAAAGG
CATATATAACTTTACACATACATATATATCATCATACATGTACACATACCCATACACATA
CACATACNTAAATGTAATTGACTTCTGTTCGGAAGTAAGATACCGACCAGTGAGAAGAAT
CTCTCACATGAGAATCTATCTCTTATCTAANATGGACAACAGTTCTCAGTCATTGCATGC
TTTTGGGTATTGACACTCTACGAAAATATAAACTTANCAAATGTCATACTTGCTTGTGTA
TATAGATTTNGGGTAAATACATGCATAAATGTCGATNAATTATATTGAAACTTTCATTGA
TGCTTTTGAAATTAACCCAAAGGGACC
GenBank Accession BX288602 [GenBank]
Graphic View Graphic view of sequence BX288602 of line 418B02
Predicted Position of Insertion Chr5:23850397 - go to primer design
BLAST e Value 7e-98
Hit Clone Code (BAC ID) K18B18
Insertion Classification Genome Hit
Confirmation Status unknown


Last Updated on 14.10.2014 10:23