Sequences from confirmation amplicon


Confirmation sequences for line 420D02 and hit At2g36800 are shown.
Line ID 420D02
Locus At2g36800 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr2:15425185
Primers used for PCR HF02 - 8474, show primer details
   
Sequence Name 06-K024506-022-420-D02C-HF02
GenBank Accession LN488638 [GenBank]
Sequencing primer gene specific primer, HF02: 5'-GGTTTTTGTGCTTGTTGTAAAGTG-3'
Sequence (A. th genome BLAST matches underlined)
>06-K024506-022-420-D02C-hf2
TATGTTTTCATCTTGTAAAGGATATTGTCACTCGTGTGTCATCTCTATTACCAAACTCAG
GAAAGAAACATTCACACGAAATTGTTGTAGGCTGTGGTCCTCTTTTTATTGATTATAATT
TTTGAGGCTAGTGTTGGATATACTTGTCTTGACAGAGTCCAACGTTTGATTTATCTTCAG
TTAGTGTTTCATATGAGAGTTTAAACGGTCTTTGAAGTTTCAAACACACATTAGATTTTG
GTAACATTGGTAATTTATTTATGTGGCCTCTATGTTTATTTTGATTTTTGAGACTTGACG
ATAGATGTAGCTATCACTATCAGTGAGCCCTCCAAGTTGTTGTTTTGTGTATGTGAATTA
TCTTCGTTTTCTTTATGAAGATATGTTTCTAAACTTTTCCTGAGAAGGAAGGTCACTACG
ATATATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTAT
GATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGT
AGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGACAAATTACGAT
CCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTATTTC
GACGTGTCTA
   
Sequence Name 05-K024506-022-420-D02C-8409
GenBank Accession LN488188 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>05-K024506-022-420-D02C-8409
GTAGATTTCCCGGACATGAAGCCATTTACAATTGAATATATCGTAGTGACCTTCCTTCTC
AGGAAAAGTTTAGAAACATATCTTCATAAAGAAAACGAAGATAATTCACATACACAAAAC
AACAACTTGGAGGGCTCACTGATAGTGATAGCTACATCTATCGTCAAGTCTCAAAAATCA
AAATAAACATAGAGGCCACATAAATAAATTACCAATGTTACCAAAATCTAATGTGTGTTT
GAAACTTCAAAGACCGTTTAAACTCTCATATGAAACACTAACTGAAGATAAATCAAACGT
TGGACTCTGTCAAGACAAGTATATCCAACACTAGCCTCAAAAATTATAATCAATAAAAAG
AGGACCACAGCCTACAACAATTTCGTGTGAATGTTTCTTTCCTGAGTTTGGTAATAGAGA
TGACACACGAGTGACAATATCCTTTACAAGATGAAAACATAATACACTTTACAACA

Last Updated on 07.07.2016 14:16