SimpleSearch - Line and FST details


Line specific information

 
Line ID 420D02
Vector Used pAC161
Line Availability only available from NASC (N440262)
Segregation Analysis 50:50:37
Confirmed for Hit At2g36800
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g36800

 
Sequence (A. th genome BLAST matches underlined)
>12-K018101-022-420-D02-8409
TTCCCGGACTGAAGCCTTTACATTGAATATATCGAGTGACCTTCCTTCTCAGGAAAAGTT
TAGAAACATATCTTCATAAAGAAAACGAAGATAATTCACATACACAAAACAACAACTTGG
AGGGCTCACTGATAGTGATAGCTACATCTATCGTCAAGTCTCAAAAATCAAAATAAACAT
AGAGGCCACATAAATAAATTACCAATGTTACCAAAATCTAATGTGTGTTTGAAACTTCAA
AGACCGTTTAAACTCTCATATGAAACACTAACTGAAGATAAATCAAACGTTGGACTCTGT
CAAGACAAGTATATCCGACGCTATGGGATCCTCCCTTATAGTGA
GenBank Accession BX288832 [GenBank]
Graphic View Graphic view of gene At2g36800
Predicted Position of Insertion Chr2:15425190 - go to primer design
BLAST e Value 4e-158
Hit Clone Code (BAC ID) F13K3
Hit Gene Code At2g36800 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation don-glucosyltransferase 1
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03