Sequences from confirmation amplicon


Confirmation sequences for line 422C06 and hit At2g14760 are shown.
Line ID 422C06
Locus At2g14760 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr2:6323429
Primers used for PCR LD04 - 8474, show primer details
   
Sequence Name 19-K023835-022-422-C06C-8409
GenBank Accession LN494591 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>19-K023835-022-422-C06C-8409
GTAGATTTCCCGGACATGAAGCCATTTACAATTGAAAATCCGATAAGTAATGTAGATTTC
CCGGATCATGAGAAGTAATGGATATAATTAAATGTCAACCAATAAAACATTATAACCATC
TTTAGAATAAAGTATTTTTTTGGGTAACCAGGTCTTGATACCCATAGATATGAACAGCTA
ATTATAGAGCTTAAAGAAAGCTTTGTCTTTCTCTATATCTGTTAAGCATGAGTTAAAATC
TGTATTTAGTCATTGGTAATTCAATACAAAAAGAAGAGGATCAGACCTATACAAATCCTT
GGAGGGGAGATAAATCCAGGTTCAACTGTATCTATTATGTTAATAATATAGAGTTGTGAA
GAAAATAATGAATGTAAGGAAAAGGTACAACTAGGAAAAAATATAATTGTGATGTATCAA
TCCCAAAACCAGGGACTTATACATATGTTTAATTTATAATTGATGTATAGAAGACCTTTG
CATTTGAGGATTTGTTTGAGCAAGTCTAAAATATGAAAAACAATCTCTTTCTAGTTACAG
TCGCTATGATTGGTTCAAGTTCTTAAAAAAACGGTTAACAATTTGTTTTAGTGGTTGGAG
GAAACG
   
Sequence Name 23-K023835-022-422-C06C-LD04
GenBank Accession LN496397 [GenBank]
Sequencing primer gene specific primer, LD04: 5'-TTGGTATTCTCTAACCGTTTCCTC-3'
Sequence (A. th genome BLAST matches underlined)
>23-K023835-022-422-C06C-LD04
CCACTAAAACAAATTCGTTAACCGTTTTTTTAAGAACTTGAACCAATCATAGCGACTGTA
ACTAGAAAGAGATTGTTTTTCATATTTTAGACTTGCTCAAACAAATCCTCAAATGCAAAG
GTCTTCTATACATCAATTATAAATTAAACATATGTATAAGTCCCTGGTTTTGGGATTGAT
ACATCACAATTATATTTTTTCCTAGTTGTACCTTTTCCTTACATTCATTATTTTCTTCAC
AACTCTATATTATTAACATAATAGATACAGTTGAACCTGGATTTATCTCCCCTCCAAGGA
TTTGTATAGGTCTGATCCTCTTCTTTTTGTATTGAATTACCAATGACTAAATACAGATTT
TAACTCATGCTTAACAGATATAGAGAAAGACAAAGCTTTCTTTAAGCTCTATAATTAGCT
GTTCATATCTATGGGTATCAAGACCTGGTTACCCAAAAAAATACTTTATTCTAAAGATGG
TTATAATGTTTTATTGGTTGACATTTAATTATATCCATTACTTCTCATGATCCGGGAAAT
CTACATTACTTATCGGATTTTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGA
TCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTT

Last Updated on 07.07.2016 14:16